PhAc-ALGP-Dox

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

The anthracycline including doxorubicin (DOX), daunorubicin (DAU) and mitoxantrone (MTX) plays crucial roles in human health due to their notably clinical efficacy in various malignant tumors. There is few molecular probe and abiotic sensor that can simultaneously discriminate among anthracycline drugs. Herein, a target-response ratiometric and turn-off fluorescent dual-mode platform was designed for simultaneous detection of multiple anticancer drugs based on blue-emitting carbon dots (BCDs). In the presence of anthracycline, specific absorption and formation of the BCDs-anthracycline conjugate was achieved via electrostatic interaction and hydrophobic force, leading to ratiometric signal or quenched fluorescent response, thereby achieving ratiometric or turn-off dual-mode detection. Specifically, the introduction of both DOX and DAU produce ratiometric response of BCDs due to fluorescence resonance energy transfer (FRET) and dynamic quenching while MTX only induce reduced fluorescent response attribute to photoinduced electron transfer (PET) and dynamic quenching. The linear range calculated is 1-98, 1-91 and 1-77 μM for DOX, DAU and MTX, respectively, with a limit of detection of 0.02, 0.05 and 0.06 μM. Taking advantage of target-response self-verification ratiometric and sensitive fluorescent detection, the dual-mode platform was proposed and applied for successful discrimination of anthracycline drugs. This study opens a new path for multiplex drugs analysis in a facile and rapid way.