Delving into the Latest Updates on PhAc-ALGP-Dox with Synapse

Overview

Basic Info

Drug Type

Peptide drug conjugates

Synonyms-

Target

Top II

Action

inhibitors

Mechanism

Top II inhibitors(Topoisomerase II inhibitors)

Therapeutic Areas

Neoplasms

Active Indication

Solid tumor

Inactive Indication-

Originator Organization

Katholieke Universiteit Leuven

University of Strasbourg

Active Organization

University of Strasbourg

Katholieke Universiteit Leuven

Inactive Organization-

License Organization-

Drug Highest PhasePreclinical

First Approval Date-

Regulation-

Structure/Sequence

Molecular FormulaC45H58N5O19P

InChIKeyQCFYQOZHDGXKKN-AAKRKBFRSA-N

CAS Registry1616592-31-4

Boost your research with our ADC technology data.

login

or

view full example data

Boost your research with our ADC technology data.

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

31 Dec 2025·DRUG DELIVERY

Incorporation of doxorubicin into plant-derived nanovesicles: process monitoring and activity assessment

Article

Author: Mucha, Piotr ; Jaikishan, Shishir ; Wielgomas, Bartosz ; Kalinowski, Leszek ; Heinz, Andrea ; Płoska, Agata ; Czyrski, Grzegorz S. ; Waleron, Krzysztof ; Wiedmer, Susanne K. ; Dziomba, Szymon ; Chen, Rui ; Targońska, Monika ; Jasiecki, Jacek ; Steć, Aleksandra

Extracellular vesicles (EVs) are an experimental class of drug carriers. Alternative sources of EVs are currently being explored to overcome limitations related to their manufacturing from mesenchymal stem cells. In this work, Citrus limon-derived EVs were tested as carriers for the widely used chemotherapeutic drug - doxorubicin (DOX). Capillary electrophoresis (CE) and nanoplasmonic sensing (NPS) were developed for the quality control of DOX-EV preparations. It was found that the CE method enables simultaneous detection of free and incorporated DOX and allows assessing the stability of the preparations and the drug leakage. NPS, on the other hand, demonstrated that DOX is accumulated in the interfacial region of the carrier. The activity of DOX-loaded EVs was tested on HeLa (cervical cancer cells) and HEK293T (human embryonic kidney cells) cell lines. It was found that DOX incorporation into plant-derived EVs virtually does not affect the drug's cytotoxicity to HeLa cells but significantly decreases DOX activity against HEK293T cell line.

01 Dec 2025·MOLECULAR BIOLOGY REPORTS

Human papillomavirus E6 alters Toll-like receptor 9 transcripts and chemotherapy responses in breast cancer cells in vitro

Article

Author: Selander, Katri ; Jukkola, Arja ; Ravaioli, Sara ; Parviainen, Essi ; Manninen, Aki ; Nurmenniemi, Sini ; Bravaccini, Sara

Abstract:

Background:

Toll-like receptor 9 (TLR9) is a DNA recognizing receptor expressed also in several cancers. Decreased TLR9 expression is associated with poor prognosis in triple negative breast cancer (TNBC), but the role of TLR9 in breast cancer pathophysiology is currently unclear. Regulation of TLR9 expression in breast cancer is poorly understood. Human papillomavirus (HPV) infections suppress TLR9 expression in cervical cancers but the association between HPV and breast cancer has remained controversial. The aim of this study was to test if HPV16 can suppress TLR9 expression in breast cancer cells and affect cell behavior.

Methods and results:

Human T-47D and MDA-MB-231 breast cancer cells were transduced with lentivirus encoding HPV16 E6 oncoprotein. The effects of E6 on TLR9 mRNA and protein expression, and cell proliferation, migration, invasion and sensitivity to chemotherapy were studied in vitro. Breast cancer tissue samples (n = 37) were analyzed for the presence of HPV DNA. E6 expression decreased TLR9 mRNA expression in MDA-MB-231 and T-47D cells in hypoxia. E6 expression altered breast cancer cell proliferation and made cells significantly less sensitive to the growth inhibitory effects of chemotherapeutic agents. HPV L1 gene was not detected in a small pilot cohort of clinical breast cancer specimens.

Conclusion:

HPV16 may influence breast cancer cell TLR9 transcription and chemotherapy responses and could thereby affect breast cancer prognosis. These results suggest that HPV may have a previously unrecognized role in breast cancer pathophysiology and warrant further studies on the topic.

100 Deals associated with PhAc-ALGP-Dox

Login to view more data

R&D Status

10 top R&D records.

Login

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Solid tumor	Preclinical	Belgium	Katholieke Universiteit Leuven	11 Feb 2022
Solid tumor	Preclinical	France	University of Strasbourg	11 Feb 2022

Login to view more data

Clinical Result

Indication

Phase

Evaluation

View All Results

Login to view more data

Translational Medicine

Boost your research with our translational medicine data.

login

or

view full example data

Boost your research with our translational medicine data.

Deal

Boost your decision using our deal data.

login

or

view full example data

Boost your decision using our deal data.

Core Patent

Boost your research with our Core Patent data.

login

or

view full example data

Boost your research with our Core Patent data.

Clinical Trial

Identify the latest clinical trials across global registries.

login

or

view full example data

Identify the latest clinical trials across global registries.

Approval

Accelerate your research with the latest regulatory approval information.

login

or

view full example data

Accelerate your research with the latest regulatory approval information.

Biosimilar

Competitive landscape of biosimilars in different countries/locations. Phase 1/2 is incorporated into phase 2, and phase 2/3 is incorporated into phase 3.

login

or

view full example data