Request Demo
Last update 25 Jun 2025
Zoptarelin Doxorubicin
Last update 25 Jun 2025
Overview
Basic Info
Drug Type Peptide drug conjugates |
Synonyms Zoptarelin Doxorubicin Acetate, Zoptrex, AEZS-108 + [3] |
Target |
Action agonists, inhibitors |
Mechanism GNRH1 agonists(gonadotropin releasing hormone 1 agonists), Top II inhibitors(Topoisomerase II inhibitors) |
Therapeutic Areas |
Active Indication- |
Originator Organization |
Active Organization- |
License Organization |
Drug Highest PhaseDiscontinuedPhase 3 |
First Approval Date- |
RegulationOrphan Drug (United States) |
Login to view timeline
Structure/Sequence
Molecular FormulaC91H117N19O26 |
InChIKeyOOUACICUAVTCEC-LZHWUUGESA-N |
CAS Registry139570-93-7 |
Boost your research with our ADC technology data.
login
or
Sequence Code 14109089
Source: *****
Related
6
Clinical Trials associated with Zoptarelin DoxorubicinNCT01767155
Randomized Controlled Study Comparing AEZS-108 With Doxorubicin as Second Line Therapy for Locally Advanced, Recurrent or Metastatic Endometrial Cancer.
NCT01698281
A Randomized Phase 2 Trial of AEZS-108 in Chemotherapy Refractory Triple Negative, LHRH-positive Metastatic Breast Cancer.
EUCTR2012-000134-19-DE
A randomised, phase 2 trial of AEZS-108 in chemotherapy refractory triple negative (ER/PR/HER2-negative) LHRH-R positive metastatic breast cancer - AEZS-108 in patients with LHRH receptor positive breast cancer
100 Clinical Results associated with Zoptarelin Doxorubicin
Login to view more data
100 Translational Medicine associated with Zoptarelin Doxorubicin
Login to view more data
100 Patents (Medical) associated with Zoptarelin Doxorubicin
Login to view more data
56,785
Literatures (Medical) associated with Zoptarelin Doxorubicin31 Dec 2025DRUG DELIVERY
Incorporation of doxorubicin into plant-derived nanovesicles: process monitoring and activity assessment
Article
Author: Mucha, Piotr ; Jaikishan, Shishir ; Wielgomas, Bartosz ; Kalinowski, Leszek ; Heinz, Andrea ; Płoska, Agata ; Czyrski, Grzegorz S. ; Waleron, Krzysztof ; Wiedmer, Susanne K. ; Dziomba, Szymon ; Chen, Rui ; Targońska, Monika ; Jasiecki, Jacek ; Steć, Aleksandra
Extracellular vesicles (EVs) are an experimental class of drug carriers. Alternative sources of EVs are currently being explored to overcome limitations related to their manufacturing from mesenchymal stem cells. In this work, Citrus limon-derived EVs were tested as carriers for the widely used chemotherapeutic drug - doxorubicin (DOX). Capillary electrophoresis (CE) and nanoplasmonic sensing (NPS) were developed for the quality control of DOX-EV preparations. It was found that the CE method enables simultaneous detection of free and incorporated DOX and allows assessing the stability of the preparations and the drug leakage. NPS, on the other hand, demonstrated that DOX is accumulated in the interfacial region of the carrier. The activity of DOX-loaded EVs was tested on HeLa (cervical cancer cells) and HEK293T (human embryonic kidney cells) cell lines. It was found that DOX incorporation into plant-derived EVs virtually does not affect the drug's cytotoxicity to HeLa cells but significantly decreases DOX activity against HEK293T cell line.
31 Dec 2025Hematology
Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML
Article
Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong
OBJECTIVE:
Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).
METHODS:
The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).
RESULTS:
The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.
CONCLUSIONS:
We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.
01 Dec 2025MOLECULAR BIOLOGY REPORTS
Human papillomavirus E6 alters Toll-like receptor 9 transcripts and chemotherapy responses in breast cancer cells in vitro
Article
Author: Selander, Katri ; Jukkola, Arja ; Ravaioli, Sara ; Parviainen, Essi ; Manninen, Aki ; Nurmenniemi, Sini ; Bravaccini, Sara
Abstract:
Background:
Toll-like receptor 9 (TLR9) is a DNA recognizing receptor expressed also in several cancers. Decreased TLR9 expression is associated with poor prognosis in triple negative breast cancer (TNBC), but the role of TLR9 in breast cancer pathophysiology is currently unclear. Regulation of TLR9 expression in breast cancer is poorly understood. Human papillomavirus (HPV) infections suppress TLR9 expression in cervical cancers but the association between HPV and breast cancer has remained controversial. The aim of this study was to test if HPV16 can suppress TLR9 expression in breast cancer cells and affect cell behavior.
Methods and results:
Human T-47D and MDA-MB-231 breast cancer cells were transduced with lentivirus encoding HPV16 E6 oncoprotein. The effects of E6 on TLR9 mRNA and protein expression, and cell proliferation, migration, invasion and sensitivity to chemotherapy were studied in vitro. Breast cancer tissue samples (n = 37) were analyzed for the presence of HPV DNA. E6 expression decreased TLR9 mRNA expression in MDA-MB-231 and T-47D cells in hypoxia. E6 expression altered breast cancer cell proliferation and made cells significantly less sensitive to the growth inhibitory effects of chemotherapeutic agents. HPV L1 gene was not detected in a small pilot cohort of clinical breast cancer specimens.
Conclusion:
HPV16 may influence breast cancer cell TLR9 transcription and chemotherapy responses and could thereby affect breast cancer prognosis. These results suggest that HPV may have a previously unrecognized role in breast cancer pathophysiology and warrant further studies on the topic.
100 Deals associated with Zoptarelin Doxorubicin
Login to view more data
External Link
| KEGG | Wiki | ATC | Drug Bank |
|---|---|---|---|
| - | Zoptarelin Doxorubicin | - |
R&D Status
10 top R&D records. to view more data
Login
| Indication | Highest Phase | Country/Location | Organization | Date |
|---|---|---|---|---|
| Metastatic endometrial cancer | Phase 3 | United States | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Austria | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Belarus | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Belgium | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Bosnia and Herzegovina | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Bulgaria | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Canada | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Czechia | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Denmark | 01 Apr 2013 | |
| Metastatic endometrial cancer | Phase 3 | Finland | 01 Apr 2013 |
Login to view more data
Clinical Result
Clinical Result
Indication
Phase
Evaluation
View All Results
Phase 3 | 511 | (AEZS-108 / Zoptarelin Doxorubicin) | zcpjldxrtd = doiisgiodt mnwruwrefp (wwxnyrsdor, sivcrkrxrt - xktulpokrl) View more | - | 31 Jul 2018 | ||
(Doxorubicin/ Standard Chemotherapy) | zcpjldxrtd = pdxjjoloyo mnwruwrefp (wwxnyrsdor, ddgrsztzah - bicuhqapej) View more | ||||||
Phase 3 | Endometrial Carcinoma Second line | 511 | chndznzowk(uocngqtbbn) = wrusjchans tvvtyacnfr (jlkaypuvsx ) View more | Negative | 05 Jun 2018 | ||
doxorubicin | chndznzowk(uocngqtbbn) = fbsxgjdxjv tvvtyacnfr (jlkaypuvsx ) View more | ||||||
Phase 2 | Castration-Resistant Prostatic Cancer Second line | Third line | 25 | vkycfumxox(orvepptpyi) = kgrdbgztnv vvjfkccilt (cdsfyyuqct ) View more | Positive | 16 Feb 2017 | ||
Phase 1 | 13 | drsarcbpst(milhbdtivv) = taqbybxmxq qcpfobrfeb (ygyerzpmkn ) | - | 20 May 2014 | |||
Phase 1 | 18 | wwelapnccn(bkifyqfdqu) = gbxhejqtkd rojlxtuoqk (ndcnoggkhk ) | - | 20 May 2013 | |||
Phase 2 | 43 | qdmhoqwgol(hhwwqumdgk) = xrrxwqxxxc lyxhhpfjwb (slmwaufybe ) View more | - | 20 May 2010 | |||
Phase 1 | - | osccdlcbtf(ogbpwqvfqb) = One pt at this dose level had an allergic skin reaction during infusion, subsequent cycles with anti-allergic pre-medication were tolerated owlhwgxydg (zvudvfzlzs ) View more | - | 20 Jun 2007 |
Login to view more data
Translational Medicine
Boost your research with our translational medicine data.
login
or
Deal
Boost your decision using our deal data.
login
or
Core Patent
Boost your research with our Core Patent data.
login
or
Clinical Trial
Identify the latest clinical trials across global registries.
login
or
Approval
Accelerate your research with the latest regulatory approval information.
login
or
Biosimilar
Competitive landscape of biosimilars in different countries/locations. Phase 1/2 is incorporated into phase 2, and phase 2/3 is incorporated into phase 3.
login
or
Regulation
Understand key drug designations in just a few clicks with Synapse.
login
or
AI Agents Built for Biopharma Breakthroughs
Accelerate discovery. Empower decisions. Transform outcomes.
Get started for free today!
Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.
Start your data trial now!
Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.
Bio
Bio Sequences Search & Analysis
Sign up for free
Chemical
Chemical Structures Search & Analysis
Sign up for free