Request Demo

Last update 25 Jun 2025

Azacitidine

Last update 25 Jun 2025

Overview

R&D Status

Clinical Result

Translational Medicine

Overview

Basic Info

Drug Type

Small molecule drug

Synonyms

4-amino-1-beta-D-ribofuranosyl-s-triazin-2(1H)-one, 5-azacytidine, 5-AZC

+ [19]

Target

DNMT1

Action

inhibitors

Mechanism

DNMT1 inhibitors(DNA (cytosine-5)-methyltransferase 1 inhibitors), DNA methylation inhibitors

Therapeutic Areas

NeoplasmsHemic and Lymphatic DiseasesOther Diseases+ [3]

Active Indication

Juvenile Myelomonocytic LeukemiaMyeloproliferative DisordersPhiladelphia chromosome positive chronic myelogenous leukemia+ [49]

Inactive Indication

Acute Erythroblastic LeukemiaAcute lymphoblastic leukemia recurrentAcute Myeloid Leukemia with FLT3/ITD Mutation+ [79]

Originator Organization

Celgene Corp.

Active Organization

betapharm Arzneimittel GmbH

AbbVie, Inc.

Takeda Pharmaceutical Co., Ltd.

+ [17]

Inactive Organization

ARIAD Pharmaceuticals, Inc.

Millennium Pharmaceuticals, Inc.

Pharmacyclics LLC

+ [11]

License Organization

Agios Pharmaceuticals, Inc.

The University of Texas MD Anderson Cancer Center

Drug Highest PhaseApproved

First Approval Date

United States (19 May 2004),

Myelodysplastic Syndromes

RegulationOrphan Drug (United States), Orphan Drug (Japan), Orphan Drug (South Korea), Accelerated assessment (European Union), Priority Review (China)

Structure/Sequence

Molecular FormulaC8H12N4O5

InChIKeyNMUSYJAQQFHJEW-KVTDHHQDSA-N

CAS Registry320-67-2

814

Clinical Trials associated with Azacitidine

NCT06611839

/ Not yet recruitingPhase 1/2IIT

A Multicenter, Single-arm Clinical Study of Venetoclax and Ivosidenib Combined With Intensive Chemotherapy in the Treatment of Fit Adult Acute Myeloid Leukemia Patients With IDH1 Mutations

Leukemia is one of the common malignant tumors threatening human health. Intensive chemotherapy or non-intensive chemotherapy has limited efficacy. There is an urgent need to improve treatment outcomes with more specific, well-designed drugs that target leukemia specifically.
The induction therapy of venetoclax combined with demethylation agents (HAM) significantly improves the response rate in elderly unfit AML patients (more than 60%), and studies are being conducted in venetoclax combination with intensive induction (3 + 7) and consolidation chemotherapy in newly treated AML patients.
Isocitrate dehydrogenase (IDH) 1 and 2 are present in the citric acid cycle. About 20% of AML patients carry IDH1 or IDH2 mutations that result in the reduction of alpha-ketoglutaric acid to 2-hydroxyglutaric acid (2-HG), which methylates intracellular histones and inhibits TET2 activity to hypermethylate DNA, thereby affecting gene expression and cell differentiation. IDH mutations are more common in older patients, are often cytogenetically-related, and can also co-occur with FLT3-ITD, NPM1, or DNMT3A mutations. Ivosidenib is an IDH1 inhibitor, and its safety and efficacy in the treatment of AML have been confirmed in previous studies. Based on the study of Montesinos et al. on the role of ivosidenib and azacitidine in IDH-mutated AML, for patients who cannot tolerate intensive chemotherapy, a new treatment regimen has been added for AML patients with IDH1 mutation: ivosidenib combined with azacitidine can be selected for 1 cycle every 28 days or ivosidenib monotherapy.
Therefore, this study intends to conduct a multi-center, single-arm clinical study to determine the maximum tolerated dose of ivosidenib and venetoclax combined chemotherapy, and the composite complete response rate, the negative conversion rate of MRD measured by flowcytometry and IDH1 mutant.

Start Date30 Oct 2025

Sponsor / Collaborator

Hematology Hospital of Chinese Academy of Medical Sciences

NCT07007312

/ Not yet recruitingPhase 3

Phase 3 Randomized, Double-blind, Placebo-controlled Studies Assessing Ziftomenib in Combination With Either Standard of Care Nonintensive (Venetoclax+Azacitidine) or Intensive (7+3) Therapy in Patients With Untreated NPM1 Mutated or KMT2A Rearranged Acute Myeloid Leukemia

Ziftomenib is an investigational drug in development for the treatment of patients with acute myeloid leukemia (AML) with eligible genetic alterations. Ziftomenib is a type of therapy known to target the menin pathway in cancer cells.
This protocol has 2 separate studies that will investigate the benefits and risks of adding ziftomenib to standard-of-care (SOC) AML treatments in patients with certain genetic mutations who have not received any treatment for their AML. In the first study, the Nonintensive Therapy Study, older patients or those with serious medical problems will receive the SOC therapies venetoclax (ven) and azacitidine (aza), plus either ziftomenib or a placebo. In the second study, the Intensive Therapy Study, medically fit patients will receive (a) the SOC therapies cytarabine and daunorubicin, plus either ziftomenib or a placebo during a first treatment phase called induction, (b) cytarabine plus either ziftomenib or a placebo during a second treatment phase called consolidation, and (c) ziftomenib or a placebo during a third treatment phase called maintenance.
The physician will determine which study is the appropriate treatment for the patient, but neither the patient nor their physician will know whether the patient has been assigned to receive ziftomenib or a placebo. This design is called "double-blinded".

Start Date01 Sep 2025

Sponsor / Collaborator

Kura Oncology, Inc.

NCT05554419

/ Not yet recruitingPhase 2IIT

Eradicating Measurable Residual Disease in Patients With Acute Myeloid Leukemia (AML) Prior to StEm Cell Transplantation (ERASE): A MyeloMATCH Treatment Trial

This phase II MyeloMATCH treatment trial compares cytarabine versus (vs.) cytarabine and venetoclax vs. liposome-encapsulated daunorubicin-cytarabine and venetoclax vs. azacitidine and venetoclax for treating patients who have residual disease after treatment for acute myeloid leukemia (AML). Cytarabine is in a class of medications called antimetabolites. It works by slowing or stopping the growth of cancer cells in the body. Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking Bcl-2, a protein needed for cancer cell survival. Liposome-encapsulated daunorubicin-cytarabine is a drug formulation that delivers daunorubicin and cytarabine in small spheres called liposomes, which may make the drugs safer or more effective. Azacitidine is a drug that interacts with DNA and leads to the activation of tumor suppressor genes, which are genes that help control cell growth. This study may help the study doctors find out if the different drug combinations are equally effective to the usual approach of cytarabine alone while requiring a shorter duration of treatment. To decide if they are better, the study doctors will be looking to see if the study drugs lead to a higher percentage of patients achieving a deeper remission compared to cytarabine alone.

Start Date29 Aug 2025

Sponsor / Collaborator

National Cancer Institute

100 Clinical Results associated with Azacitidine

100 Translational Medicine associated with Azacitidine

100 Patents (Medical) associated with Azacitidine

9,468

Literatures (Medical) associated with Azacitidine

31 Dec 2025·ANNALS OF MEDICINE

Significant prognostic improvement in elderly patients with acute myeloid leukemia treated with hypomethylating agents and venetoclax: outcomes from a retrospective real-world analysis

Article

Author: Zheng, Jing ; Wu, Yong ; Chen, Yi ; Wu, Lanlan ; Zhou, Jiayi ; Wu, Zhengjun ; Cai, Ruyu ; Wang, Zhengyang

OBJECTIVE:

This investigation aim to analyze the clinical features and therapeutic outcomes of elderly patients with acute myeloid leukemia (AML).

METHOD:

We conducted a retrospective analysis of the clinical and cytogenetic profiles of patients aged 60 years and older diagnosed with AML at the Fujian Medical University Union Hospital from 2016 to 2024.

RESULTS:

Our study cohort included 846 patients, with a median age of 67 years. The median duration of response (DOR) was 15.8 months, with 1-year, 3-year, and 5-year DOR rates of 55.3%, 23.4%, and 13.1%, respectively. The median overall survival (OS) was 21.8 months, with corresponding 1-year, 3-year, and 5-year OS rates of 58.7%, 41.2%, and 30.0%. Patients who received the azacitidine and venetoclax treatment protocol exhibited a complete remission (CR) rate of 57.1% and a minimal residual disease (MRD) - negative rate of 34.1%. These rates were comparable to the 59.2% CR rate and 39.4% MRD-negative rate observed in patients treated with intensive chemotherapy, and were superior to those with other low-intensity regimens. Compared to the treatment outcomes achieved at our center prior to 2016, when chemotherapy was the predominant treatment modality, which were characterized by a CR rate of 42.7%, a median OS of 9.2 months, and a mere 5-year OS rate of 13.5%, the remission rate and long-term survival of elderly patients with AML have been remarkable improved.

CONCLUSION:

The integration of hypomethylating agents and venetoclax into the treatment paradigm for elderly patients with AML has significantly enhanced survival rates.

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

01 Dec 2025·MOLECULAR BIOLOGY REPORTS

Effects of 5-azacytidine and N6-methyladenosine combination on apoptosis and stemness in human breast cancer stem cells

Article

Author: Mukhtarova, Gunel ; Angin, Mesude ; Caner, Ayse ; Gunduz, Cumhur

BACKGROUND:

This study investigates the combined effects of the epigenetic anticancer drug 5-azacytidine (5-Aza) and N6-methyladenosine (m6A) on breast cancer stem cells (CSCs) and normal breast epithelial cells. CSCs are characterized by their ability to self-renew, their resistance to conventional therapies, and their role in metastasis, presenting a significant challenge in breast cancer treatment.

METHODS AND RESULTS:

The study utilized flow cytometry to isolate CD44 + /CD24low CSCs from MCF-7 breast cancer cells and evaluated these cells through spheroid formation assays. The results demonstrated that both 5-Aza and m6A, both individually and in combination, exert cytotoxic effects on CSCs, induce apoptosis, and reduce their migratory capacity. Importantly, these treatments did not produce similar effects on normal breast epithelial cells (MCF-10A), indicating selective action on CSCs. Gene expression analysis revealed that treatment with 5-Aza, m6A, and their combination altered the expression of key stem cell-related genes, including OCT4, NANOG, SOX2, and c-MYC, which are associated with CSC self-renewal and malignancy.

CONCLUSIONS:

These findings suggest that epigenetic modulation through 5-Aza and m6A could effectively target CSCs, disrupting their ability to drive tumor progression and metastasis, particularly in aggressive breast cancer subtypes. This study highlights the potential of 5-Aza and m6A as a combinatorial therapeutic approach, offering a promising avenue for improving treatment outcomes in breast cancer patients, especially those with therapy-resistant disease. Further clinical investigation is needed to validate these findings and explore their therapeutic implications.

800

News (Medical) associated with Azacitidine

25 Jun 2025

·www.echemi.com

Venetoclax Falls Short in 15 Month MDS Survival Challenge but Hope Remains

Venetoclax, approved by the FDA in 2016 for treating 17p-deleted chronic lymphocytic leukemia (CLL), has been a blockbuster drug in hematologic cancers, earning over $2 billion in sales in 2024. Despite its success in acute myeloid leukemia (AML), AbbVie’s ambitions to expand Venetoclax into the myelodysplastic syndrome (MDS) market have faced significant setbacks. MDS, a hematologic malignancy with an average survival of only 15 months and a 5-year survival rate below 20%, presents major challenges for drug development due to heterogeneous disease profiles and the lack of effective models. Current standard treatments, such as hypomethylating agents (HMAs) like azacitidine and decitabine, often result in drug resistance, leaving more than 50% of patients without alternatives. Venetoclax, a BCL-2 inhibitor, offers a chemo-free approach by inducing mitochondrial apoptosis. Encouraged by its success in AML, AbbVie initiated clinical trials targeting MDS. In a Phase 1b trial involving 107 patients, Venetoclax combined with azacitidine showed promising response rates, with 29.9% achieving complete remission (CR) and a median overall survival (OS) of 26 months. However, all patients experienced adverse events, raising concerns about its safety. The drug’s Phase 3 trial, critical for regulatory approval, failed to demonstrate a significant survival benefit for MDS patients. Experts attribute this to MDS's greater reliance on MCL-1 rather than BCL-2, making Venetoclax less effective in this population. Additionally, TP53 mutations, present in up to 90% of MDS patients, further limit efficacy by disrupting DNA repair pathways. Beyond efficacy, Venetoclax’s toxicity profile poses challenges. Its apoptosis-inducing effects harm healthy bone marrow cells, exacerbating anemia and neutropenia in MDS patients, who are already vulnerable to life-threatening infections. Despite this setback, the unmet clinical need in MDS remains significant. Other BCL-2 inhibitors, including Ascentage Pharma’s APG-2575, are showing promising Phase 1 results, with ORR reaching 75% in relapsed/refractory MDS patients. The race to capture the MDS market, estimated in billions of dollars, is far from over.

Clinical ResultPhase 1Drug ApprovalPhase 3Phase 2

20 Jun 2025

·www.prnewswire.com

LOMOND THERAPEUTICS ANNOUNCES U.S. FDA CLEARANCE OF IND APPLICATION FOR LONITOCLAX, A SELECTIVE BCL2 INHIBITOR WITH LIMITED IMMUNE SUPPRESSION AND IMPROVED SAFETY COMPARED TO VENETOCLAX AND VENETOCLAX- LIKE MOLECULES

DOVER, Del., June 20, 2025 /PRNewswire/ -- Lomond Therapeutics Holdings, Inc. ("Lomond Therapeutics"), a clinical-stage biotechnology company dedicated to discovering and developing potentially best-in-class and first-in-class medicines for the treatment of hematological malignancies, today announced that the U.S. Food and Drug Administration (FDA) has cleared it's Investigational New Drug (IND) application for a Phase 1 multicenter study evaluating the feasibility, safety, and efficacy of lonitoclax in patients with relapsed/refractory acute myeloid leukemia (AML). Continue Reading "The acceptance of our third U.S. IND is an important milestone for Lomond Therapeutics", said Iain Dukes, Chief Executive Officer of Lomond Therapeutics. "This IND clearance allows us to begin the next stages of our clinical development for lonitoclax focusing on acute myeloid leukemia (AML). Through this Phase 1 study, we aim to advance our understanding of safety, tolerability, manufacturing feasibility and mechanism of action of lonitoclax." Lomond Therapeutics today announced that the U.S. FDA has cleared it's IND application for a Phase 1 multicenter study Post this About Lomond Therapeutics Lomond Therapeutics is a biopharmaceutical company co-founded by Orbimed, Torrey Pines Investment and Dr. John C. Byrd, focused on the discovery and development of best-in-class and first-in-class small molecule inhibitors that target escape mutations in hematologic and solid cancers. The company is utilizing a proprietary hybrid AI platform of Expert Systems Inc., leveraging its key partners proprietary data, chem/bio tools, knowledge and expertise to choose highly valuable molecular mechanism of pathology, to rationally design, accelerate discovery and optimize development of best-in-class and first-in-class therapies. Lomond Therapeutics' goal is to utilize its capabilities and platform to become a leader in developing novel breakthrough medicines to maximize the clinical benefit when treating hematologic and solid malignancies. For more information visit . About Lonitoclax Lonitoclax has earlier reported novel binding, best-in-class potency and selectivity against BCL2, a key pro-survival protein that is overexpressed in many cancers. To mitigate the hematologic and immune toxicities observed with venetoclax, lonitoclax was designed with a unique binding to improve selectivity for Bcl-2 over Bcl-xL. In addition, a shorter half-life and reduced P4503A4 inhibition properties were built into the molecule to mitigate tumor lysis syndrome and drug accumulation risk, respectively. Lonitoclax has demonstrated monotherapy activity in pre-clinical models, as well as synergistic activity when combined with azacytidine, FLT3 inhibitors, and menin inhibitors in AML xenograft models. Unlike venetoclax, lonitoclax had minimal immunosuppressive activity on B cells, CD8 T cells, and NK cells in preclinical models. Lonitoclax has completed a series of healthy volunteer studies where no significant safety signals were observed at exposures where ex vivo activation of caspase in CLL primary cells was observed, a surrogate marker of BCL-2 inhibition in tumors. This emphasizes important advantages over venetoclax and venetoclax-like molecules in safety, tolerability and feasibility of outpatient treatment, enabling the molecule to safely target AML and CLL patients alone and in combination with other targeted therapies. About the Phase 1 Clinical Trial The Phase 1 study will evaluate the safety, tolerability, pharmacokinetics, and anti-tumor activity of lonitoclax in combination with azacitidine in R/R AML. The study will include a dose escalation and an expansion phase with up to 60 total participants. Lomond Therapeutics is planning to initiate the study in the third quarter of 2025 across multiple investigative sites. Forward Looking Statements This press release contains forward-looking statements. Statements in this press release that are not purely historical are forward-looking statements. Such forward-looking statements include, among other things, references to our product candidates and the development and therapeutic potential thereof, statements regarding the timing, progress and results of our clinical studies and trials for our current product candidates, including statements regarding the timing of completion or initiation of trials, and the reporting of data from our current trials, our plans relating to the clinical development of our product candidates, the beneficial characteristics of our product candidates, the timing of regulatory filings and approvals for our product candidates, our ability to obtain and maintain regulatory approval for our product candidates, the expected potential benefits of strategic collaborations with related and third parties, our technologies for identifying additional product candidates and our business and development plans. Actual results could differ from those projected in any forward-looking statements due to numerous factors. Such factors include, among others, our ability to raise the additional funding we will need to continue to pursue our business and product development plans, the inherent uncertainties associated with developing product candidates and operating as a development stage company, our ability to identify additional product candidates for development, our ability to develop, complete clinical trials for, obtain approvals for and commercialize any of our product candidates, and competition in the industry in which we operate and market conditions. Investors should consult all of the information set forth herein and should also refer to additional risks set forth under the heading "Risk Factors" in Lomond Therapeutics' filings with the U.S. Securities and Exchange Commission (SEC) available at . These forward-looking statements are made as of the date of this press release, and Lomond Therapeutics assumes no obligation to update the forward-looking statements, or to update the reasons why actual results could differ from those projected in the forward-looking statements, except as required by law. Media Contact: Amy Burd CSO [email protected] SOURCE Lomond Therapeutics WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

Phase 1IND

20 Jun 2025

·www.globenewswire.com

Aptose and Hanmi Enter New Loan Agreement to Advance Development of Tuspetinib in Triplet Therapy for AML

SAN DIEGO and TORONTO, June 20, 2025 (GLOBE NEWSWIRE) -- Aptose Biosciences Inc. ("Aptose" or the "Company") (TSX: APS; OTC: APTOF), a clinical-stage precision oncology company developing a tuspetinib (TUS) based triple drug frontline therapy to treat patients with newly diagnosed acute myeloid leukemia (AML), today announced that it has entered into a new loan agreement (the “Loan Agreement”) with Hanmi Pharmaceutical Co. Ltd. (“Hanmi”). The Loan Agreement is an uncommitted facility for up to US$8.5million, administered through multiple advances for the purpose of continued clinical development of TUS. The Loan Agreement constitutes a “related-party transaction” within the meaning of Multilateral Instrument 61-101 – Protection of Minority Security Holders in Special Transactions (“MI 61-101”) as Hanmi is a related party of the Company under Canadian securities laws. However, the Company is relying on the exemption from the formal valuation and minority shareholder approval requirements contained in MI 61-101 on the basis of the “financial hardship” exemption therein. “Aptose is incredibly grateful for Hanmi’s continued support tuspetinib,” said William G. Rice, Ph.D., Chairman, President and Chief Executive Officer of Aptose. “Our data to date in the TUS+VEN+AZA triplet reveal promising antileukemic activity and safety across diverse AML populations – some with the greatest unmet needs.” Tuspetinib is a convenient once daily oral agent that potently targets SYK, mutated and wild type forms of FLT3, mutated KIT, JAK1/2, and RSK2 kinases, while avoiding many typical toxicity concerns observed with other agents. The ongoing TUSCANY triplet Phase 1/2 study is designed to test various doses and schedules of TUS in combination with standard dosing of azacitidine and venetoclax in newly diagnosed patients with AML who are ineligible to receive induction chemotherapy. Aptose recently reported early data from the first two dose cohorts that have demonstrated safety, CRs and minimal residual disease (MRD) negativity across patients with diverse mutations (press release here). About Aptose Aptose Biosciences is a clinical-stage biotechnology company committed to developing precision medicines addressing unmet medical needs in oncology, with an initial focus on hematology. The Company's small molecule cancer therapeutics pipeline includes products designed to provide single agent efficacy and to enhance the efficacy of other anti-cancer therapies and regimens without overlapping toxicities. The Company’s lead clinical-stage compound tuspetinib (TUS), is an oral kinase inhibitor that has demonstrated activity as a monotherapy and in combination therapy in patients with relapsed or refractory acute myeloid leukemia (AML) and is being developed as a frontline triplet therapy in newly diagnosed AML. For more information, please visit www.aptose.com. Forward Looking Statements This press release may contain forward-looking statements within the meaning of Canadian and U.S. securities laws, including statements relating but not limited to, the use of proceeds of the Loan Facility Agreement, the development of tuspetinib, the timing of the first advance under the Loan Facility Agreement, and statements relating to the Company’s plans, objectives, expectations and intentions and other statements including words such as “continue”, “expect”, “intend”, “will”, “should”, “would”, “may”, and other similar expressions. Such statements reflect our current views with respect to future events and are subject to risks and uncertainties and are necessarily based upon a number of estimates and assumptions that, while considered reasonable by us are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors could cause our actual results, performance or achievements to be materially different from any future results, performance or achievements described in this press release. Such factors could include, among others: our ability to negotiate a collaboration agreement to jointly develop tuspetinib with Hanmi, our ability to remain compliant with Nasdaq listing requirements and other risks detailed from time-to-time in our ongoing quarterly filings, annual information forms, annual reports and annual filings with Canadian securities regulators and the United States Securities and Exchange Commission. Should one or more of these risks or uncertainties materialize, or should the assumptions set out in the section entitled "Risk Factors" in our filings with Canadian securities regulators and the United States Securities and Exchange Commission underlying those forward-looking statements prove incorrect, actual results may vary materially from those described herein. These forward-looking statements are made as of the date of this press release and we do not intend, and do not assume any obligation, to update these forward-looking statements, except as required by law. We cannot assure you that such statements will prove to be accurate as actual results and future events could differ materially from those anticipated in such statements. Investors are cautioned that forward-looking statements are not guarantees of future performance and accordingly investors are cautioned not to put undue reliance on forward-looking statements due to the inherent uncertainty therein. For further information, please contact: Aptose Biosciences Inc. Susan Pietropaolo Corporate Communications & Investor Relations 201-923-2049 spietropaolo@aptose.com

License out/in

100 Deals associated with Azacitidine

External Link

KEGG	Wiki	ATC	Drug Bank
D03021	Azacitidine	L01BC07	DB00928

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Juvenile Myelomonocytic Leukemia	United States	Bristol Myers Squibb Co.	20 May 2022
Myeloproliferative Disorders	European Union	betapharm Arzneimittel GmbH	24 Mar 2020
Myeloproliferative Disorders	Iceland	betapharm Arzneimittel GmbH	24 Mar 2020
Myeloproliferative Disorders	Liechtenstein	betapharm Arzneimittel GmbH	24 Mar 2020
Myeloproliferative Disorders	Norway	betapharm Arzneimittel GmbH	24 Mar 2020
Philadelphia chromosome positive chronic myelogenous leukemia	China	Bristol-Myers Squibb Pharma EEIG	24 Apr 2017
High Risk Myelodysplastic Syndrome	Australia	Celgene Pty Ltd.	30 Nov 2009
Acute Myeloid Leukemia	European Union	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Acute Myeloid Leukemia	Iceland	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Acute Myeloid Leukemia	Liechtenstein	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Acute Myeloid Leukemia	Norway	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	European Union	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	Iceland	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	Liechtenstein	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	Norway	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Myelodysplastic Syndromes	United States	Bristol Myers Squibb Co.	19 May 2004

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Immunoblastic Lymphadenopathy	Phase 3	Japan	Celgene Corp.	06 Nov 2018
Thrombocytopenia	Phase 3	United States	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Australia	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Belgium	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Brazil	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Canada	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Czechia	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Denmark	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Finland	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	France	Celgene Corp.	26 Apr 2013

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


EHA2025 Manual	Not Applicable	Peripheral T-Cell Lymphoma	14	Linperlisib + Azacitidine	tkfkpoygds(vhpmxxxkuk) = wjnckesmao xdaqrsbujp (euhozmhvyb ) View more	Positive	12 Jun 2025
NCT00629343 (CTgov)	Phase 1	Mesothelioma, Malignant \| Soft Tissue Sarcoma	27	Temozolomide+Azacitidine	dmwamjsmck = cgwkdnpfot nwhvyhjvis (tnsbsxbqsz, zicpglfuyd - wscnmlfmga) View more	-	05 Jun 2025
ASCO2025	Not Applicable	High Risk Myelodysplastic Syndrome	105	azacitidine (Elderly patients (≥75 years))	xhlbnnnhba(jshpyqfefm) = Neutropenia, thrombocytopenia, and anemia rates were higher in older patients compared to younger patients. Treatment delays were more common in elderly patients, mostly due to infection complications. Causes of death were similar between the two groups, including disease progression, sepsis, febrile neutropenia, and pneumonia. zvocjzpyma (skvdtfoqqf )	Positive	30 May 2025
ASCO2025	Not Applicable	High Risk Myelodysplastic Syndrome	105	azacitidine (Younger patients (<75 years))		Positive	30 May 2025
NCT02124174 (ASCO2025)	Phase 2	Acute Myeloid Leukemia \| High Risk Myelodysplastic Syndrome Maintenance	50	Azacitidine	fynyepwayv(zydpedcalw) = txjxasnspu htaacwovzm (whromytfkp ) View more	Positive	30 May 2025
ASCO2025	Not Applicable	Acute Myeloid Leukemia	-	Azacitidine plus Venetoclax	ngpyydtwet(rydrdlqnce): HR = 1.15 (95% CI, 0.93 - 1.41), P-Value = 0.190 View more	Positive	30 May 2025
ASCO2025	Not Applicable	Acute Myeloid Leukemia	-	Intensive Chemotherapy		Positive	30 May 2025
ASCO2025	Not Applicable	Acute Myeloid Leukemia	32	Venetoclax/Azacitidine	zvgwprcldl(dhyfdlzvvh) = xwebpjtwqr ionzubfzff (fyglrfnmhz, 22.8 - 84.6) View more	Positive	30 May 2025
ASCO2025	Not Applicable	Acute Myeloid Leukemia	32	Intensive Chemotherapy (Cytarabine/Idarubicin-based)	zvgwprcldl(dhyfdlzvvh) = njbptfdknf ionzubfzff (fyglrfnmhz, 39.5 - 85.4) View more	Positive	30 May 2025
NCT04752163 (CTgov)	Phase 1/2	Relapsing acute myeloid leukemia \| Acute lymphoblastic leukemia recurrent \| Chronic Myelomonocytic Leukemia ... View more	17	DS-1594b (Phase I (DS-1594b) Cohort 1)	tsjtwqvsae = pufegbodxz tdmjegwgkt (uzbugwgvdc, vdmwekvmiw - mlzdjmccrl) View more	-	23 May 2025
NCT04752163 (CTgov)	Phase 1/2		17	DS-1594b (Phase I (DS-1594b) Cohort 2)	tsjtwqvsae = wqrkurqwle tdmjegwgkt (uzbugwgvdc, nyeonggbti - ejrwugczls) View more	-	23 May 2025
ATS2025	Not Applicable	Pleural Effusion	-	Azacitidine	zajbkghwvd(ekxpxqusrl) = A case of a massive pleural effusion due to azacitidine therapy ffqyickhhw (blmjvpkcxn )	-	16 May 2025
PS1934 (EHA2025)	Not Applicable	Immunoblastic Lymphadenopathy TET2 \| DNMT3A \| IDH2 ... View more	48	Azacitidine + CHOP	tnmfppqauj(yvghrhsgkt) = sutzzsnftc toorrlvezi (helzwcrotg ) View more	Positive	14 May 2025
ORION-AML (EHA2025)	Not Applicable	Acute Myeloid Leukemia	-	Azacitidine plus Venetoclax	cmppapmniy(rabekuoeiy) = sjzkpkcucu ywmjvyljuj (emmqgcxkqq ) View more	Positive	14 May 2025

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

AI Agents Built for Biopharma Breakthroughs

Accelerate discovery. Empower decisions. Transform outcomes.

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis