Delving into the Latest Updates on Azacitidine with Synapse

Overview

Basic Info

Drug Type

Small molecule drug

Synonyms

4-amino-1-beta-D-ribofuranosyl-s-triazin-2(1H)-one, 5-azacytidine, 5-AZC

+ [20]

Target

DNMT1

Action

inhibitors

Mechanism

DNMT1 inhibitors(DNA (cytosine-5)-methyltransferase 1 inhibitors), DNA methylation inhibitors, Epigenetic drug

Therapeutic Areas

NeoplasmsHemic and Lymphatic DiseasesOther Diseases+ [5]

Active Indication

Juvenile Myelomonocytic LeukemiaMyeloproliferative DisordersPhiladelphia chromosome positive chronic myelogenous leukemia+ [51]

Inactive Indication

Acute Erythroblastic LeukemiaAcute Myeloid Leukemia with FLT3/ITD MutationAdult Acute Myeloblastic Leukemia+ [77]

Originator Organization

Celgene Corp.

Active Organization

Bristol-Myers Squibb Pharma EEIG

Takeda Pharmaceutical Co., Ltd.

Celgene Corp.

+ [18]

Inactive Organization

Pfizer Inc.

Millennium Pharmaceuticals, Inc.Schering-Plough Corp.

+ [12]

License Organization

Agios Pharmaceuticals, Inc.

The University of Texas MD Anderson Cancer Center

Drug Highest PhaseApproved

First Approval Date

United States (19 May 2004),

Myelodysplastic Syndromes

RegulationOrphan Drug (United States), Orphan Drug (Japan), Orphan Drug (South Korea), Accelerated assessment (European Union), Priority Review (China)

Login to view timeline

Structure/Sequence

Molecular FormulaC8H12N4O5

InChIKeyNMUSYJAQQFHJEW-KVTDHHQDSA-N

CAS Registry320-67-2

The purpose of this research study is to test the safety and efficacy of a new drug combination with three agents, azacitidine, venetoclax and tagraxofusp. Leftover (residual) leukemia disease that is not visible by eye can be increase the chance of disease recurrence. This research study is to determine if the combination therapy can safely help to control residual Acute Myeloid Leukemia (AML) and to prevent disease recurrence.
The names of the study drugs involved in this study are:
* Tagraxofusp (a type of CD123-directed cytotoxin)
* Azacitidine (a type of standard of care cytidine nucleoside analog)
* Venetoclax (a type of standard of care BCL-2 inhibitor)

Start Date01 Feb 2026

Sponsor / Collaborator

Dana-Farber Cancer Institute, Inc.

[+1]

NCT06782542

/ RecruitingPhase 2IIT

Single-Arm Phase 2 Study of Olutasidenib, Venetoclax, and Azacitidine in IDH1 Mutated Newly Diagnosed Acute Myeloid Leukemia Patients Who Are Eligible for Intensive Induction Chemotherapy

The purpose of this study is as follows:
1. Determine whether people receiving the combination treatment of olutasidenib, venetoclax, and azacitidine have the same, more, or fewer side effects compared to the usual chemotherapy treatment that people with this condition receive.
2. Determine how well the combination treatment of olutasidenib, venetoclax, and azacitidine works compared to the usual chemotherapy treatment that people with this condition receive.

Start Date01 Feb 2026

Sponsor / Collaborator

University of Miami

[+1]

NCT07148947

/ Not yet recruitingPhase 2IIT

A Phase 2 Trial Investigating the Addition of Pacritinib to a Hypomethylating Agent as a Bridge to Allogeneic Hematopoietic Stem Cell Transplant in Patients With Accelerated and Blast Phase Myeloproliferative Neoplasms

This phase II trial tests if adding pacritinib to standard of care azacitidine or decitabine increases the number of patients able to proceed to hematopoietic stem cell transplantation (bridging) for patients with accelerated and blast phase myeloproliferative neoplasms. Pacritinib may stop the growth of cancer cells by blocking some of the enzymes needed for cell growth. Azacitidine and decitabine are in a class of medications called hypomethylation agents. They work by helping the bone marrow produce normal blood cells and by killing abnormal cells in the bone marrow. Cedazuridine is in a class of medications called cytidine deaminase inhibitors. It prevents the breakdown of decitabine, making it more available in the body so that decitabine will have a greater effect. Adding pacritinib to standard of care azacitidine or decitabine may increase the number of patients able to proceed to hematopoietic stem cell transplantation for patients with accelerated and blast phase myeloproliferative neoplasms.

Start Date01 Feb 2026

Sponsor / Collaborator

University of Washington

[+1]

100 Clinical Results associated with Azacitidine

Login to view more data

100 Translational Medicine associated with Azacitidine

Login to view more data

100 Patents (Medical) associated with Azacitidine

Login to view more data

8,249

Literatures (Medical) associated with Azacitidine

31 Dec 2025·ANNALS OF MEDICINE

Significant prognostic improvement in elderly patients with acute myeloid leukemia treated with hypomethylating agents and venetoclax: outcomes from a retrospective real-world analysis

Article

Author: Zheng, Jing ; Wu, Yong ; Chen, Yi ; Wu, Lanlan ; Zhou, Jiayi ; Wu, Zhengjun ; Cai, Ruyu ; Wang, Zhengyang

OBJECTIVE:

This investigation aim to analyze the clinical features and therapeutic outcomes of elderly patients with acute myeloid leukemia (AML).

METHOD:

We conducted a retrospective analysis of the clinical and cytogenetic profiles of patients aged 60 years and older diagnosed with AML at the Fujian Medical University Union Hospital from 2016 to 2024.

RESULTS:

Our study cohort included 846 patients, with a median age of 67 years. The median duration of response (DOR) was 15.8 months, with 1-year, 3-year, and 5-year DOR rates of 55.3%, 23.4%, and 13.1%, respectively. The median overall survival (OS) was 21.8 months, with corresponding 1-year, 3-year, and 5-year OS rates of 58.7%, 41.2%, and 30.0%. Patients who received the azacitidine and venetoclax treatment protocol exhibited a complete remission (CR) rate of 57.1% and a minimal residual disease (MRD) - negative rate of 34.1%. These rates were comparable to the 59.2% CR rate and 39.4% MRD-negative rate observed in patients treated with intensive chemotherapy, and were superior to those with other low-intensity regimens. Compared to the treatment outcomes achieved at our center prior to 2016, when chemotherapy was the predominant treatment modality, which were characterized by a CR rate of 42.7%, a median OS of 9.2 months, and a mere 5-year OS rate of 13.5%, the remission rate and long-term survival of elderly patients with AML have been remarkable improved.

CONCLUSION:

The integration of hypomethylating agents and venetoclax into the treatment paradigm for elderly patients with AML has significantly enhanced survival rates.

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

31 Dec 2025·Epigenetics

CpG island demethylation and recruitment of SP1 to the promoter region regulates human thymic stromal lymphopoietin expression

Article

Author: Surjit, Milan ; Ganti, Krishna Priya

Thymic Stromal Lymphopoietin (TSLP), an immunomodulatory cytokine, plays a pivotal role in the development and progression of atopic and allergic diseases. Atopy follows familial inheritance, and genome-wide studies have shown association of atopy with TSLP polymorphisms. Here, we analysed the conserved transcriptional regulatory elements in the human TSLP promoter, which revealed the presence of three CpG islands. Demethylation of the CpG island using 5-azacytidine or siRNA-mediated knockdown of DNA methyl transferases significantly upregulated TSLP expression. Sequence analysis revealed the presence of two overlapping SP1 transcription factor DNA-binding sites (DBSs), between -1494 and -1510 nucleotides on the human TSLP promoter. Further experiments showed that demethylation of the CpG island enables the binding of SP1 to its cognate DBS present on the TSLP promoter, resulting in its transcriptional activation. Moreover, retinoic acid-induced transcription of human TSLP was associated with CpG island demethylation and SP1 binding to the TSLP promoter. These findings unravel a distinct mechanism of transcriptional regulation of the human TSLP gene and suggest possible epigenetic regulation of TSLP expression in modulating atopic and allergic disease severity in different individuals.

884

News (Medical) associated with Azacitidine

11 Dec 2025

·www.prnewswire.com

Five Leading Cancer Centers Unite to Target CD123 and Eradicate Hidden Leukemia Cells

A multi-site trial pairs targeted therapy with next-generation MRD testing to track residual disease and uncover vulnerabilities in leukemia cells CAMBRIDGE, Mass., Dec. 11, 2025 /PRNewswire/ -- Acute myeloid leukemia (AML) is an aggressive blood cancer, with overall survival remaining approximately 30% at five years despite advances in therapy. Even when patients achieve remission, the disease often returns, fueled by a small number of leukemia cells that survive initial treatment, known as measurable residual disease (MRD). These remaining cells are major drivers of relapse and are linked with poorer outcomes, yet no standard therapy exists to eliminate them. Addressing MRD has become one of the most urgent clinical challenges in AML, and the focus of the 'Eradicating Measurable Residual Disease in AML' Break Through Cancer TeamLab. Continue Reading "MRD is like the bulk of an iceberg hidden beneath the surface. We can treat the disease we see, but the real challenge is determining how much remains unseen" said Jacqueline Garcia, assistant professor of medicine at Harvard Medical School and medical oncologist at Dana-Farber Cancer Institute and lead investigator on the trial. "We have billions of blood cells in our body, and the questions are: How much disease is truly left over? How do we measure it? And how do we quantify our patient's risk?" Five cancer centers unite to target CD123 and eliminate residual leukemia cells driving relapse in AML patients Post this Why Target CD123 CD123, a leukemia cell-surface marker present in more than 80% of cases, is involved in cancer cell growth and survival and is especially elevated in high-risk subtypes. "We wanted a study that could have broad reach across more subgroups of patients," said Garcia. "CD123 is present on the surface of AML cells and early leukemia stem cells which makes it a meaningful way to target residual disease." This multi-site study will evaluate targeting CD123 in combination with two established AML therapies. Tagraxofusp (Stemline), a CD123-directed immunotoxin already FDA-approved for another blood cancer, "binds to cells expressing CD123, and delivers a diptheria toxin payload directly into the cell," Garcia explained. Work led by fellow TeamLab investigator Dr. Andrew Lane, co-leader of the Dana-Farber/Harvard Cancer Center Leukemia Program, showed that azacitidine and venetoclax can boost sensitivity and enhance anti-leukemic activity in this combination, forming the scientific rationale for combining all three therapies. "By adding two approved treatments for active AML, we're testing if this combination can safely eradicate leftover disease and convert patients from MRD positive to negative" Garcia noted. Early clinical signals reinforce this strategy. In a recent phase 1b study in patients with newly diagnosed AML, this combination achieved a 69% response rate, and among patients in remission, nearly 71% achieved MRD-negativity. A Trial Designed to Learn as well as Treat This phase 1/2 trial (NCT07148180) is now active at Dana-Farber Cancer Institute and will be jointly conducted across four of Break Through Cancer's clinical centers including Memorial Sloan Kettering Cancer Center, The University of Texas MD Anderson Cancer Center, and the Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins. Harnessing the deep expertise within the Eradicating Measurable Residual Disease in AML TeamLab across the four clinical sites and MIT's Koch Institute for Integrative Cancer Research, this study will generate an unusually rich scientific dataset. Blood and bone marrow samples collected throughout treatment will be analyzed using state-of-the-art approaches such as circulating tumor DNA profiling, single-cell sequencing and immunophenotyping, and advanced proteomic analyses. "Alongside routine clinical tests, we are also developing new ultrasensitive assays to detect low levels of residual disease and running research assays to learn why certain leukemia cells persist," added Garcia. Together, these integrated analyses are designed to monitor how patients respond, reveal why MRD occurs, how it evolves, and which vulnerabilities may be exploited to improve future treatment strategies. By pairing deep biological discovery with clinical testing, the TeamLab aims to both eradicate MRD today and reshape how residual disease is detected and addressed in AML going forward. "This study is part of Break Through Cancer's broader work addressing minimal residual disease," said Tyler Jacks, PhD, president of Break Through Cancer. "Eliminating every last cancer cell is a formidable challenge, but one we can meaningfully advance when apply to best of science and work together." About Break Through Cancer Founded in 2021, Break Through Cancer empowers outstanding researchers and physicians to both intercept and find cures for several of the deadliest cancers by stimulating radical collaboration among outstanding cancer research institutions, including its founding partners: Dana-Farber Cancer Institute, Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Memorial Sloan Kettering Cancer Center, MIT's Koch Institute for Integrative Cancer Research, and The University of Texas MD Anderson Cancer Center. The Foundation is supported by a Board of Directors from the five partner institutions and a Scientific Advisory Board of U.S. cancer experts. The Foundation was launched with an extraordinary challenge pledge of $250 million from Mr. and Mrs. William H. Goodwin, Jr. and their family, and the estate of William Hunter Goodwin III. For further information, please visit the Foundation's website at . Media Contact: Soracha Ward [email protected] SOURCE Break Through Cancer 21% more press release views with Request a Demo

Clinical ResultPhase 1Immunotherapy

11 Dec 2025

·www.fiercebiotech.com

Moderna taps Nanexa to improve delivery of injectable therapies in back-loaded $500M pact

Moderna initially only has a license to use PharmaShell on one undisclosed compound.\n Moderna has tapped Swedish long-acting drug formulation company Nanexa to improve the delivery of up to five injectable therapies.The heavily back-loaded deal will see Moderna hand over just $3 million upfront, with up to $500 million tied to potential option fees and milestone payments, alongside tiered single-digit royalties on sales if any resulting drugs are approved.Moderna has spied potential in Nanexa’s PharmaShell platform, which covers drug microparticles in a highly protective, extremely thin film coating of slow-dissolving nontoxic inorganic oxides at the atomic level. The idea is that this enables a high drug load to be delivered to patients in a low injection volume.Nanexa has already penned collaborations with the likes of AstraZeneca and Novo Nordisk. In August, the Swedish company announced it had signed an agreement with an unnamed Big Pharma to apply its PharmaShell tech to a “specific drug with current yearly sales exceeding $1 billion.”The deal with Moderna, announced Wednesday evening, will involve assessing the potential of PharmaShell “to enhance the release profile of Moderna’s selected compounds.”Moderna initially only has a license to use PharmaShell on one undisclosed compound, but the mRNA company has an option to then obtain a license to use the tech on up to four additional compounds once it has conducted preclinical evaluation.“We are excited to partner with Moderna, a pioneer and leader in the field of mRNA medicines, to explore the potential of our PharmaShell platform and to support the development of improved products for Moderna,” Nanexa CEO David Westberg said in the Dec. 10 release. “This agreement underscores the versatility of PharmaShell and its potential to address key challenges in the delivery of advanced biologics,” Westberg added.As well as its Big Pharma collaborations, Nanexa has been working on its own pipeline of formulations led by NEX-22, a sustained-release formulation of diabetes med Victoza. The company was also evaluating new formulations of Bristol Myers Squibb’s myeloma drug Revlimid and its leukemia drug Vidaza, but both programs are labeled as “suspended” on Nanexa’s website.Moderna, an mRNA specialist known for its COVID-19 vaccine Spikevax, has been turning its focus toward its oncology programs in recent months. In November, the company announced it was winding down development of three clinical mRNA programs, including two investigational vaccines for infectious diseases.

VaccineLicense out/inmRNA

10 Dec 2025

·mendus.com

Mendus Announces Summary of Data Presented at ASH

Mendus AB (publ; IMMU.ST), a biopharmaceutical company focused on immunotherapies targeting tumor recurrence, today announced a summary of the data presented related to its lead product vididencel during the ASH conference, held Dec 6-9 in Orlando, FL, USA. The data support the company’s clinical development strategy, set out to position vididencel broadly as a post-remission immunotherapy in acute myeloid leukemia (AML), for patients treated with conventional intensive chemotherapy (IC) or a combination of venetoclax and azacitidine (ven+aza). Updated results from the European ADVANCE II Phase 2 trial continue to demonstrate robust relapse-free and overall survival benefit in a high-risk AML population, based on the presence of persistent measurable residual disease (MRD) following IC. At a median follow-up of 55 months, 13 out of 20 patients treated with vididencel were still alive, with 8 patients having passed 5-year follow-up and estimated 5-year overall survival standing at 63%. Immunological data tracked with survival and no associations with tumor genetics were observed, confirming that vididencel acts as an active immunotherapy against residual disease across different subtypes of AML. The poster presented at ASH is available on the Mendus website, please visit this link. Vididencel is currently being studied in combination with oral azacitidine to improve relapse-free and overall survival for patients with or without MRD following IC in the ongoing Australian AMLM22-CADENCE randomized Phase 2b trial, led by Prof. Andrew Wei (Peter MacCallum Cancer Center, Melbourne, Australia). Based on the registration trial for oral azacitidine, the overall 5-year survival for this patient population is below 30% (26.5% for oral aza versus 20.1% for placebo1). The study design of the trial was presented at ASH by the Australasian Leukaemia and Lymphoma Group, as the sponsor of the trial.1Wei et al., Am J Hematol. (2023); 98:E84–E87 For elderly patients unfit for IC, the introduction of venetoclax in combination with azacitidine has led to significant improvements in overall survival versus azacitidine alone in this patient population. At ASH, data were presented from the pivotal randomized PARADIGM trial2, comparing ven+aza with conventional IC in newly diagnosed fit adults with AML. The favorable outcomes reported for ven+aza over IC in this fit patient population are expected to support a wider use of ven+aza as first-line treatment in AML. Mendus is therefore preparing the DIVA Phase 1b combination trial, which will study safety and feasibility of vididencel in combination with ven+aza to address this growing patient population. The DIVA trial will also be led by Prof. Wei and is anticipated to start in the first half of 2026.2Fathi et al., Blood (2025) 146 (Supplement 1): 6. “Increasing clinical evidence supports the expanding use of ven-aza to treat newly diagnosed fit adults with AML, particularly with release of the provocative data from the PARADIGM trial presented at ASH this year”, said Prof. Andrew Wei. “We therefore look forward to studying vididencel immunotherapy in patients treated with ven-aza, next to the ongoing combination trial with oral aza in the post-IC setting.” Mendus had previously communicated its updated clinical strategy, aimed at further expanding the addressable patient population in the AML treatment landscape and with chronic myeloid leukemia (CML) as a new indication. “The continued strong proof-of-concept data of the ADVANCE II trial presented at ASH confirm the potential of vididencel as a safe, efficacious and broadly applicable active immunotherapy in AML,” said Mendus Chief Medical and Scientific Officer, Prof. Tariq Mughal. “The evolution of first-line treatment of AML, driven by the clinical success of ven-aza, is now also an integral part of our development strategy. This will allow us to define the optimal go-to-market strategy and global registration trial for vididencel in AML, while we are entering CML as an additional indication. These steps will significantly expand the addressable patient population and market potential for vididencel.” About vididencelVididencel is an off-the-shelf, active immunotherapy designed to stimulate immune control of residual disease and improve disease-fee and overall survival following first-line treatment of tumors with a high recurrence rate. In clinical trials, vididencel treatment was safe, tolerable and associated with durable clinical remissions in high-risk acute myeloid leukemia (AML). Vididencel comprises irradiated leukemic-derived dendritic cells that are administered via simple intradermal injection. The product is manufactured using a proprietary cell line and scalable manufacturing process, which does not require patient material or genetic engineering. Vididencel has a strong regulatory dossier, including an EMA ATMP manufacturing certificate, Orphan Drug Designation (US + EU) and Fast Track Designation (US). Based on positive proof-of-concept data demonstrating that vididencel acts as an active immunotherapy in AML, Mendus is developing vididencel as a broadly applicable immunotherapy in AML and chronic myeloid leukemia (CML). For more information, please contact:Erik MantingChief Executive OfficerE-mail: ir@mendus.com About Mendus AB (publ)Mendus is dedicated to changing the course of cancer treatment by addressing tumor recurrence and improving long-term survival for cancer patients, while preserving health and quality of life. We leverage our understanding of dendritic cell biology to develop an advanced clinical pipeline of immunotherapies that combine clinical efficacy with a benign safety profile. Based in Sweden and The Netherlands, Mendus is publicly traded on the Nasdaq Stockholm under the ticker IMMU.ST. https://www.mendus.com/ AttachmentsMendus Announces Summary of Data Presented at ASH

ImmunotherapyPhase 2Orphan DrugFast TrackClinical Result

100 Deals associated with Azacitidine

Login to view more data

External Link

KEGG	Wiki	ATC	Drug Bank
D03021	Azacitidine	L01BC07	DB00928

R&D Status

Approved

10 top approved records.

Login

to view more data

Indication	Country/Location	Organization	Date
Juvenile Myelomonocytic Leukemia	United States	Bristol Myers Squibb Co.	20 May 2022
Myeloproliferative Disorders	European Union	betapharm Arzneimittel GmbH	24 Mar 2020
Myeloproliferative Disorders	Iceland	betapharm Arzneimittel GmbH	24 Mar 2020
Myeloproliferative Disorders	Liechtenstein	betapharm Arzneimittel GmbH	24 Mar 2020
Myeloproliferative Disorders	Norway	betapharm Arzneimittel GmbH	24 Mar 2020
Philadelphia chromosome positive chronic myelogenous leukemia	China	Bristol-Myers Squibb Pharma EEIG	24 Apr 2017
High Risk Myelodysplastic Syndrome	Australia	Celgene Pty Ltd.	30 Nov 2009
Acute Myeloid Leukemia	European Union	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Acute Myeloid Leukemia	Iceland	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Acute Myeloid Leukemia	Liechtenstein	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Acute Myeloid Leukemia	Norway	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	European Union	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	Iceland	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	Liechtenstein	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Chronic Myelomonocytic Leukemia	Norway	Bristol-Myers Squibb Pharma EEIG	17 Dec 2008
Myelodysplastic Syndromes	United States	Bristol Myers Squibb Co.	19 May 2004

Developing

10 top R&D records.

Login

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Immunoblastic Lymphadenopathy	Phase 3	Japan	Celgene Corp.	06 Nov 2018
Thrombocytopenia	Phase 3	United States	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Australia	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Belgium	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Brazil	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Canada	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Czechia	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Denmark	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	Finland	Celgene Corp.	26 Apr 2013
Thrombocytopenia	Phase 3	France	Celgene Corp.	26 Apr 2013

Login to view more data

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


NCT01869114 (CTgov)	Phase 2	Adult acute myeloid leukemia with del(5q) \| Myelodysplastic Syndromes \| Acute Promyelocytic Leukemia	57	sirolimus+azacitidine (Arm A: Acute Myeloid Leukemia (AML))	yjkttryolj = fbskifwdjj okswlwldqi (fzinavfbkk, dxilsnlkxw - zocqznwgvj) View more	-	10 Dec 2025
				sirolimus+azacitidine (Arm B: High risk Myleodysplastic Syndrome (MDS))	yjkttryolj = nspmarzmmy okswlwldqi (fzinavfbkk, ystvhcgrec - mresaawgpm) View more
NCT05149378 (Pubmed \| Lancet Haematol)	Phase 2	Refractory T Acute Lymphoblastic Leukemia	25	Venetoclax plus azacitidine	rnmfxqiocn(afymajjbpp) = No treatment-related serious adverse events were observed and no treatment-related deaths occurred. rpmtjfojet (qtgrgsmoze ) View more	Positive	01 Dec 2025
NCT04372433 (Pubmed \| Blood Neoplasia)	Phase 1	Acute Myeloid Leukemia \| Chronic Myelomonocytic Leukemia	18	IO-202 + azacitidine	wumngzinql(lnhalfuupm) = mhwkoytati evamikofys (welcogjayo ) View more	Positive	01 Nov 2025
ChiCTR2200063954 (Nat Rev Drug Discov) Manual	Phase 2	Acute Myeloid Leukemia First line	38	Granulocyte colony-stimulating factor + venetoclax + azacitidine	zcqszhdwpl(vyqnymgvtp) = mwypijaxjk bpiiczrrsr (gksuoucqee ) View more	Positive	27 Oct 2025
				Granulocyte colony-stimulating factor + venetoclax + azacitidine (ELN favorable risk)	zcqszhdwpl(vyqnymgvtp) = cazdjkipas bpiiczrrsr (gksuoucqee ) View more
NCT05428969 (BEXMAB, ESMO2025)	Phase 1/2	Myelodysplastic Syndromes First line	52	bexmarilimab + azacitidine (frontline HR MDS)	vbemhmrxeq(luxtpqndnw) = 25% increase of BM CD8+ T cells, already after cycle 1 hajotksuuc (stgaowbxkk ) View more	Positive	17 Oct 2025
				bexmarilimab + azacitidine (relapsed/refractory (r/r) MDS)
NCT04102020 (VIALE-M, CTgov)	Phase 3	Acute Myeloid Leukemia	112	Venetoclax+Azacitidine (Part 1: Venetoclax 400 mg + Azacitidine 20 mg/m^2)	dblkvnjyom = adqslsurym nzlwnabgyy (yzmoiaebbw, rsghdpmmtx - rkvfgubqjy) View more	-	20 Aug 2025
				Venetoclax+Azacitidine (Part 1: Venetoclax 400 mg + Azacitidine 36 mg/m^2)	dblkvnjyom = qinkrflkey nzlwnabgyy (yzmoiaebbw, rthohopkot - sjlpkgubof) View more
NCT03013998 (Pubmed \| J Clin Oncol)	Phase 1	Refractory acute myeloid leukemia NPM1m \| KMT2Ar	43	Azacitidine, Venetoclax, and Revumenib	uaoerfhhvh(crboouejka) = present in 8 (19%) patients aylnxvtxpz (tstelmqddk ) View more	Positive	10 Aug 2025
NCT02269280 (PF629, CTgov)	Phase 2	Chronic Myelomonocytic Leukemia \| Leukemia \| Myelodysplastic Syndromes	185	AZA+Azacitidine (Azacitidine (AZA) - Days 1 - 3)	juekanynjy(znoxdxtufu) = iugmpqrevy bbqyxqtaxp (tbsltsfwvg, ntikntivrg - gdfhrxzpvr) View more	-	07 Aug 2025
				Azacitidine (AZA) Days 1 - 5 (Azacitidine (AZA) - Days 1 - 5)	juekanynjy(znoxdxtufu) = jxhutzxpus bbqyxqtaxp (tbsltsfwvg, uczrghgmbk - wgdlyhyszp) View more
NCT05209152 (MDS-537, CTgov)	Phase 1	High Risk Myelodysplastic Syndrome \| Chronic Myelomonocytic Leukemia	7	AMG 176 (Part 1A Dose Exploration: AMG 176 Dose Level 1)	thhhaymmmz = kcxlayrmer xlfbbxhsjg (twvegenbxi, azhfknuqci - gjufttjbry) View more	-	14 Jul 2025
				AMG 176 (Part 1A Dose Exploration: AMG 176 Dose Level 1 Then Dose Level 2)	thhhaymmmz = rzccxagkgd xlfbbxhsjg (twvegenbxi, dltcepiqvk - hmjwfytvtk) View more
Pubmed \| Ther Adv Hematol	Phase 2	Diffuse large B-cell lymphoma recurrent	15	Azacitidine + R-GDP	jdobhqtqgg(yawccwkseb) = wxqgrlgoql repmuthbrg (lnsoqhbuxw ) View more	Positive	01 Jul 2025