Request Demo

Last update 12 Aug 2025

Decitabine

Last update 12 Aug 2025

Overview

R&D Status

Clinical Result

Translational Medicine

Overview

Basic Info

Drug Type

Small molecule drug

Synonyms

2'-deoxy-5-azacytidine, 4-Amino-1-(2-deoxy-beta-D-erythro-pentofuranosyl)-1,3,5-triazin-2(1H)-one, 4-amino-1-(2-deoxy-β-D-erythro-pentofuranosyl)-s-triazin-2(1H)-one

+ [19]

Target

DNMT1

Action

inhibitors

Mechanism

DNMT1 inhibitors(DNA (cytosine-5)-methyltransferase 1 inhibitors), Epigenetic drug

Therapeutic Areas

NeoplasmsHemic and Lymphatic DiseasesOther Diseases+ [1]

Active Indication

Anemia, RefractoryAnemia, Refractory, With Excess of BlastsChronic Myelomonocytic Leukemia+ [15]

Inactive Indication

Acute Erythroblastic LeukemiaAcute Megakaryoblastic LeukemiaAcute Monocytic Leukemia+ [37]

Originator Organization

Eisai Co., Ltd.

Active Organization

Merck Sharp & Dohme Corp.Pharmachemie BVJanssen-Cilag International NV

+ [6]

Inactive Organization

Janssen LPJanssen-Cilag GmbH

Janssen Pharmaceuticals, Inc.

+ [11]

License Organization

Janssen Pharmaceuticals, Inc.

Janssen Korea Ltd.MGI PHARMA, Inc.

+ [5]

Drug Highest PhaseApproved

First Approval Date

United States (02 May 2006),

Anemia, Refractory, With Excess of BlastsAnemia, RefractoryChronic Myelomonocytic Leukemia+ [2]

RegulationOrphan Drug (United States), Orphan Drug (European Union)

Structure/Sequence

Molecular FormulaC8H12N4O4

InChIKeyXAUDJQYHKZQPEU-KVQBGUIXSA-N

CAS Registry2353-33-5

463

Clinical Trials associated with Decitabine

NCT03184935

/ SuspendedPhase 1/2

Research for Human Umbilical Cord Mesenchymal Stem Cells in the Treatment of Myelodysplastic Syndrome (MDS)

The purposes of the study is to determine the safety and efficacy of human umbilical cord mesenchymal stem cells (hUC-MSC) in treating Myelodysplastic Syndrome patients.

Start Date31 Dec 2025

Sponsor / Collaborator

Sclnow Biotechnology Co., Ltd.

NCT07071155

/ Not yet recruitingEarly Phase 1IIT

A Pilot Study of Momelotinib in Combination With Hypomethylating Agent for Chronic Phase Myelodysplastic Syndromes/Myeloproliferative Overlap Neoplasms and Chronic Neutrophilic Leukemia (M-HArbOr)

This research is being done to evaluate effectiveness, safety, and tolerability of a study drug called momelotinib in participants with myelodysplastic/myeloproliferative neoplasms (MDS/MPNs) or chronic neutrophilic leukemia (CNL), in addition to standard treatment which usually includes a hypomethylating agent like azacitidine or decitabine. Treatment options for this diagnosis remain limited and investigators need better treatments to help control the disease, improve symptoms, and potentially help more patients become eligible for transplant.
Participants for this study will be asked to take some screening tests which will include routine physical examination, blood tests, and imaging scans to determine eligibility for the study. Those who continue to qualify for this study will begin treatment. The treatment on this study will include taking momelotinib by mouth for all patients. The first 10 patients may receive momelotinib (MMB) alone for 3 cycles before adding a standard treatment for MDS/MPN called azacitidine (HMA).
The participant may be asked to remain on the treatment for up to 24 months, depending upon how the participant is responding to the study treatment. After the study treatment is completed, the participant will have one additional clinic visit for evaluating overall health, physical examination and blood tests, that will be described later in detail.
The most common side effect that may be related to participation in this study can include (i) infections which can present as fever, chills, cough, breathing problems, diarrhea, vomiting, pain or burning with urination; or (ii) low blood platelet count which can result in bruising or bleeding for longer than usual if the participant hurts themself.

Start Date05 Nov 2025

Sponsor / Collaborator

The Sidney Kimmel Comprehensive Cancer Center

NCT07012044

/ Not yet recruitingPhase 1IIT

A Phase 1 Study of Oral Cedazuridine and Decitabine Combination (ASTX727, NSC# 820631) and Filgrastim as Maintenance Therapy Post-Hematopoietic Stem Cell Transplant in Children With High-Risk Acute Myeloid Leukemia

This phase I trial tests the safety, side effects, and best dose of ASTX727 and filgrastim for the treatment of children with high risk acute myeloid leukemia that has come back after a period of improvement (recurrent) or that does not respond to treatment (refractory) who have undergone allogenic hematopoietic stem cell transplantation. ASTX727 is a combination of cedazuridine and decitabine. Cedazuridine is in a class of medications called cytidine deaminase inhibitors. It prevents the breakdown of decitabine, making it more available in the body so that decitabine will have a greater effect. Decitabine is in a class of medications called hypomethylation agents. It works by helping the bone marrow produce normal blood cells and by killing abnormal cells in the bone marrow. Filgrastim stimulates the production of neutrophils (a type of white blood cell) which can help to prevent infection. Giving ATSX727 and filgrastim may be safe and tolerable in treating children with high risk, recurrent or refractory acute myeloid leukemia who have undergone allogenic hematopoietic stem cell transplantation.

Start Date31 Oct 2025

Sponsor / Collaborator

National Cancer Institute

100 Clinical Results associated with Decitabine

100 Translational Medicine associated with Decitabine

100 Patents (Medical) associated with Decitabine

8,612

Literatures (Medical) associated with Decitabine

31 Dec 2025·Hematology

Efficacy and safety of decitabine combined with arsenic trioxide in elderly high-risk myelodysplastic neoplasm patients: a retrospective study

Article

Author: Yang, Jianzhong

OBJECTIVES:

Elderly patients with high-risk myelodysplastic neoplasm (MDS) face poor outcomes with limited treatment options, often progressing to acute myeloid leukemia (AML). This study investigates the efficacy and safety of combining decitabine (DAC) with arsenic trioxide (ATO) as a novel therapeutic approach.

METHODS:

A retrospective analysis was conducted on 120 elderly high-risk MDS patients, with 52 receiving ATO-DAC (ATO-DAC group) and 68 receiving DAC monotherapy (DAC group). Treatment outcomes were assessed through overall response rate (ORR), progression-free survival (PFS), and overall survival (OS). Adverse events were recorded and compared between the two groups.

RESULTS:

The ATO-DAC group demonstrated a significantly higher ORR of 78.85% compared to 52.94% in the DAC group (P = 0.026). Median PFS was 7.5 months for the ATO-DAC group versus 5.0 months for the DAC group (P = 0.021), and median OS was 14.5 months compared to 11.5 months, respectively (P = 0.034). Although adverse events were more frequent in the ATO-DAC group, the safety profile remained manageable. These findings suggest that the ATO-DAC combination provides superior efficacy compared to DAC monotherapy.

DISCUSSION:

The combination of DAC and ATO offers a promising and innovative treatment option for elderly high-risk MDS patients, enhancing response rates and survival outcomes while maintaining a manageable safety profile.

CONCLUSION:

This study underscores the clinical relevance of this regimen, warranting further investigation in prospective trials.

31 Dec 2025·Hematology

Enhanced FOXO1 expression as a predictor of decitabine response and prolonged survival in high-risk myelodysplastic syndrome

Article

Author: Zhang, Zheng ; Huang, Nanfang ; Liu, Hong ; Xu, Feng ; Zhao, Sida ; Chang, Chunkang

PURPOSE:

The aim of this study was to assess the predictive role of FOXO1 expression changes in determining the response to hypomethylation therapy in patients with high-risk myelodysplastic syndrome (MDS).

METHODS:

FOXO1 mRNA levels were measured using real-time PCR in 62 newly diagnosed MDS patients undergoing decitabine treatment. The study analyzed the relationship between FOXO1 expression and clinical indicators, treatment outcomes, and prognosis.

RESULTS:

Responders exhibited significantly elevated FOXO1 levels, which were associated with improved peripheral blood counts, decreased bone marrow blasts, and enhanced T-cell immunity and polarization. Increased FOXO1 expression after four cycles of decitabine was associated with a more favorable treatment response. Univariate and multivariate Cox analyses revealed that elevated FOXO1 expression was linked to prolonged overall survival and leukemia-free survival.

CONCLUSIONS:

Elevated FOXO1 expression in high-risk MDS patients undergoing decitabine treatment enhances patient prognosis and survival.

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

170

News (Medical) associated with Decitabine

29 Jul 2025

·news.abbvie.com

AbbVie Submits for U.S. FDA Approval of Combination Treatment of VENCLEXTA® (venetoclax) and Acalabrutinib for Previously Untreated Patients with Chronic Lymphocytic Leukemia (CLL)

Oncology R&D News Combination therapy has potential to be an all-oral, fixed-duration regimen for previously untreated patients with CLL Application is supported by data from the Phase 3 AMPLIFY trial that showed statistically significant improvement in progression-free survival vs chemoimmunotherapy Regimen offers an opportunity for patients to take time off treatment, an important step toward improved disease management NORTH CHICAGO, Ill., July 29, 2025 /PRNewswire/ -- AbbVie (NYSE: ABBV) announced the submission of a supplemental New Drug Application (sNDA) to the U.S. Food and Drug Administration (FDA) for the fixed-duration, all-oral combination regimen of VENCLEXTA® (venetoclax) and acalabrutinib in previously untreated patients with CLL, offering CLL patients another VENCLEXTA combination regimen with the potential for time-limited treatment. The submission is based on the positive results from the Phase 3 AMPLIFY trial.1 The combination regimen of VENCLEXTA and acalabrutinib improved progression-free survival (PFS) compared to standard chemoimmunotherapy in previously untreated patients with CLL.2 "This FDA submission marks a milestone for CLL treatment with the potential approval for the first oral combination regimen of VENCLEXTA and acalabrutinib for previously untreated patients with chronic blood cancer. This new fixed-treatment duration approach could allow patients the opportunity for time off treatment, if approved, and be potentially practice-changing in frontline CLL care," said Svetlana Kobina, vice president, global medical affairs, oncology, AbbVie. About the AMPLIFY Study AMPLIFY is an AstraZeneca-sponsored, global, multi-center Phase 3 trial evaluating VENCLEXTA plus acalabrutinib alone or combined with obinutuzumab versus chemoimmunotherapy in patients with previously untreated CLL without del(17p) or TP53 mutation.1 Data presented at the 2024 American Society of Hematology Annual Meeting showed that the fixed-duration combination regimen of VENCLEXTA and acalabrutinib reduced the risk of disease progression or death by 35% vs chemoimmunotherapy (HR 0.65; 95% CI: 0.49-0.87; p=0.004). The safety profile of the VENCLEXTA and acalabrutinib combination regimen is consistent with the known safety profile of each individual therapy alone. The most common adverse events in any grade were neutropenia, hemorrhage, and COVID-19 in patients administered VENCLEXTA plus acalabrutinib. The most frequent Grade 3 or higher adverse event was neutropenia seen in 26.8% of patients. Among events of clinical interest, low rates of tumor lysis syndrome were observed with events of any grade seen in 0.3% of patients treated with VENCLEXTA plus acalabrutinib compared to 3.1% for patients treated with chemoimmunotherapy. No new safety signals were observed in the AMPLIFY study.2 About VENCLEXTA® (venetoclax) VENCLEXTA (venetoclax) is a first-in-class medicine that selectively binds and inhibits the B-cell lymphoma-2 (BCL-2) protein. In some blood cancers, BCL-2 prevents cancer cells from undergoing their natural death or self-destruction process, called apoptosis. VENCLEXTA targets the BCL-2 protein and works to help restore the process of apoptosis. VENCLEXTA is being developed by AbbVie and Roche. It is jointly commercialized by AbbVie and Genentech, a member of the Roche Group, in the U.S. and by AbbVie outside of the U.S. Together, the companies are committed to BCL-2 research and to studying venetoclax in clinical trials across several blood and other cancers. Venetoclax is approved in more than 80 countries, including the U.S. VENCLEXTA® (venetoclax) U.S. Uses and Important Safety Information3 Uses VENCLEXTA is a prescription medicine used: to treat adults with chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL). in combination with azacitidine, or decitabine, or low-dose cytarabine to treat adults with newly diagnosed acute myeloid leukemia (AML) who: ‒ are 75 years of age or older, or ‒ have other medical conditions that prevent the use of standard chemotherapy. It is not known if VENCLEXTA is safe and effective in children. Important Safety Information What is the most important information I should know about VENCLEXTA? VENCLEXTA can cause serious side effects, including: Tumor lysis syndrome (TLS). TLS is caused by the fast breakdown of cancer cells. TLS can cause kidney failure, the need for dialysis treatment, and may lead to death. Your healthcare provider will do tests to check your risk of getting TLS before you start taking VENCLEXTA. You will receive other medicines before starting and during treatment with VENCLEXTA to help reduce your risk of TLS. You may also need to receive intravenous (IV) fluids into your vein. Your healthcare provider will do blood tests to check for TLS when you first start treatment and during treatment with VENCLEXTA. It is important to keep your appointments for blood tests. Tell your healthcare provider right away if you have any symptoms of TLS during treatment with VENCLEXTA, including fever, chills, nausea, vomiting, confusion, shortness of breath, seizures, irregular heartbeat, dark or cloudy urine, unusual tiredness, or muscle or joint pain. Drink plenty of water during treatment with VENCLEXTA to help reduce your risk of getting TLS. Drink 6 to 8 glasses (about 56 ounces total) of water each day, starting 2 days before your first dose, on the day of your first dose of VENCLEXTA, and each time your dose is increased. Your healthcare provider may delay, decrease your dose, or stop treatment with VENCLEXTA if you have side effects. When restarting VENCLEXTA after stopping for 1 week or longer, your healthcare provider may again check for your risk of TLS and change your dose. Who should not take VENCLEXTA? Certain medicines must not be taken when you first start taking VENCLEXTA and while your dose is being slowly increased because of the risk of increased TLS. Tell your healthcare provider about all the medicines you take, including prescription and over-the- counter medicines, vitamins, and herbal supplements. VENCLEXTA and other medicines may affect each other causing serious side effects. Do not start new medicines during treatment with VENCLEXTA without first talking with your healthcare provider. Before taking VENCLEXTA, tell your healthcare provider about all of your medical conditions, including if you: have kidney or liver problems. have problems with your body salts or electrolytes, such as potassium, phosphorus, or calcium. have a history of high uric acid levels in your blood or gout. are scheduled to receive a vaccine. You should not receive a "live vaccine" before, during, or after treatment with VENCLEXTA, until your healthcare provider tells you it is okay. If you are not sure about the type of immunization or vaccine, ask your healthcare provider. These vaccines may not be safe or may not work as well during treatment with VENCLEXTA. are pregnant or plan to become pregnant. VENCLEXTA may harm your unborn baby. If you are able to become pregnant, your healthcare provider should do a pregnancy test before you start treatment with VENCLEXTA, and you should use effective birth control during treatment and for 30 days after the last dose of VENCLEXTA. If you become pregnant or think you are pregnant, tell your healthcare provider right away. are breastfeeding or plan to breastfeed. It is not known if VENCLEXTA passes into your breast milk. Do not breastfeed during treatment with VENCLEXTA and for 1 week after the last dose. What should I avoid while taking VENCLEXTA? You should not drink grapefruit juice or eat grapefruit, Seville oranges (often used in marmalades), or starfruit while you are taking VENCLEXTA. These products may increase the amount of VENCLEXTA in your blood. What are the possible side effects of VENCLEXTA? VENCLEXTA can cause serious side effects, including: Low white blood cell counts (neutropenia). Low white blood cell counts are common with VENCLEXTA, but can also be severe. Your healthcare provider will do blood tests to check your blood counts during treatment with VENCLEXTA and may pause dosing. Infections. Death and serious infections such as pneumonia and blood infection (sepsis) have happened during treatment with VENCLEXTA. Your healthcare provider will closely monitor and treat you right away if you have a fever or any signs of infection during treatment with VENCLEXTA. Tell your healthcare provider right away if you have a fever or any signs of an infection during treatment with VENCLEXTA. The most common side effects of VENCLEXTA when used in combination with obinutuzumab or rituximab or alone in people with CLL or SLL include low white blood cell counts; low platelet counts; low red blood cell counts; diarrhea; nausea; upper respiratory tract infection; cough; muscle and joint pain; tiredness; and swelling of your arms, legs, hands, and feet. The most common side effects of VENCLEXTA in combination with azacitidine or decitabine or low-dose cytarabine in people with AML include nausea; diarrhea; low platelet count; constipation; low white blood cell count; fever with low white blood cell count; tiredness; vomiting; swelling of arms, legs, hands, or feet; fever; infection in lungs; shortness of breath; bleeding; low red blood cell count; rash; stomach (abdominal) pain; infection in your blood; muscle and joint pain; dizziness; cough; sore throat; and low blood pressure. VENCLEXTA may cause fertility problems in males. This may affect your ability to father a child. Talk to your healthcare provider if you have concerns about fertility. These are not all the possible side effects of VENCLEXTA. Call your doctor for medical advice about side effects. You are encouraged to report negative side effects of prescription drugs to the FDA. Visit www.fda.gov/medwatch or call 1-800-FDA-1088. The full U.S. prescribing information, including Medication Guide, for VENCLEXTA can be found here. Globally, prescribing information varies; refer to the individual country product label for complete information. About AbbVie AbbVie's mission is to discover and deliver innovative medicines and solutions that solve serious health issues today and address the medical challenges of tomorrow. We strive to have a remarkable impact on people's lives across several key therapeutic areas including immunology, oncology, neuroscience, and eye care – and products and services in our Allergan Aesthetics portfolio. For more information about AbbVie, please visit us at www.abbvie.com. Follow @abbvie on LinkedIn, Facebook, Instagram, X (formerly Twitter), and YouTube. About AbbVie in Oncology At AbbVie, we are committed to transforming standards of care for patients living with difficult-to-treat cancers. We are advancing a dynamic pipeline of investigational therapies across a range of cancer types in both blood cancers and solid tumors. We are focusing on creating targeted medicines that either impede the reproduction of cancer cells or enable their elimination. We achieve this through various, targeted treatment modalities and biology interventions, including small molecule therapeutics, antibody-drug conjugates (ADCs), immuno-oncology-based therapeutics, multispecific antibody and in situ CAR-T platforms. Our dedicated and experienced team joins forces with innovative partners to accelerate the delivery of potential breakthrough medicines. Today, our expansive oncology portfolio comprises approved and investigational treatments for a wide range of blood and solid tumors. We are evaluating more than 20 investigational medicines in multiple clinical trials across some of the world's most widespread and debilitating cancers. As we work to have a remarkable impact on people's lives, we are committed to exploring solutions to help patients obtain access to our cancer medicines. For more information, please visit http://www.abbvie.com/oncology. Forward-Looking Statements Some statements in this news release are, or may be considered, forward-looking statements for purposes of the Private Securities Litigation Reform Act of 1995. The words "believe," "expect," "anticipate," "project" and similar expressions and uses of future or conditional verbs, generally identify forward-looking statements. AbbVie cautions that these forward-looking statements are subject to risks and uncertainties that may cause actual results to differ materially from those expressed or implied in the forward-looking statements. Such risks and uncertainties include, but are not limited to, challenges to intellectual property, competition from other products, difficulties inherent in the research and development process, adverse litigation or government action, changes to laws and regulations applicable to our industry, the impact of global macroeconomic factors, such as economic downturns or uncertainty, international conflict, trade disputes and tariffs, and other uncertainties and risks associated with global business operations. Additional information about the economic, competitive, governmental, technological and other factors that may affect AbbVie's operations is set forth in Item 1A, "Risk Factors," of AbbVie's 2024 Annual Report on Form 10-K, which has been filed with the Securities and Exchange Commission, as updated by its Quarterly Reports on Form 10-Q and in other documents that AbbVie subsequently files with the Securities and Exchange Commission that update, supplement or supersede such information. AbbVie undertakes no obligation, and specifically declines, to release publicly any revisions to forward-looking statements as a result of subsequent events or developments, except as required by law. References: US Media: Matt Skryja Matt.skryja@abbvie.com Investors: Liz Shea Liz.shea@abbvie.com SOURCE AbbVie

Phase 3Clinical ResultDrug ApprovalImmunotherapy

10 Jul 2025

·www.prnewswire.com

Can Early Intervention Prevent Leukemia? New Trial Gives Patients a Choice Beyond the Current 'Wait and See' Approach

Scientists are exploring if early intervention can prevent AML in high-risk patients, shifting the focus from monitoring to proactive prevention. CAMBRIDGE, Mass., July 10, 2025 /PRNewswire/ -- Break Through Cancer, a Boston-based cancer research foundation, has launched a clinical trial to evaluate the feasibility of early intervention for Clonal Hematopoiesis (CH), a precursor to acute myeloid leukemia (AML). This multi-institutional study focuses on high-risk patients, exploring a new approach to managing this pre-malignant condition and advancing the groundwork for preventing this aggressive blood cancer. Understanding CH and AML Risk Continue Reading Break Through Cancer launches study to test early action against AML Post this AML is a malignant blood disorder characterized by the rapid production of abnormal myeloid cells in the bone marrow and bloodstream. This aggressive cancer disrupts normal blood cell production and is associated with severe clinical outcomes, including a five-year survival rate of approximately 30%. CH can occur naturally with aging or as a consequence of chemotherapy or radiation treatment. Before receiving an AML diagnosis, many patients already have CH with AML-associated mutations, making it a pre-malignant condition. While often symptomless, some individuals with CH may have low blood counts—a condition known as Clonal Cytopenia of Uncertain Significance (CCUS). Those with high-risk CCUS have a greater than 50% chance of progressing to AML within five years. "A lot of patients have already survived one cancer, and it's devastating when they receive a diagnosis of a therapy-related AML. The ability to potentially target the disease before it progresses to that point is what really excites me," said Dr. Kelly S. Chien, Assistant Professor at The University of Texas MD Anderson Cancer Center and a clinician on the study. A New Approach: Early Intervention As part of the new interventional trial, patients diagnosed with high-risk CCUS have the opportunity to choose proactive treatment for their precursor condition. The trial (NCT06802146) will evaluate Inqovi (Astex Pharmaceuticals) in patients with high-risk CCUS, assessing the safety and feasibility of intervention at this precursor stage. Inqovi—an oral drug currently FDA-approved to treat a related blood cancer—works by altering the DNA of abnormal blood cells, thus slowing their growth and reducing the risk of progression to more advanced disease stages. The two-arm study will enroll patients with high-risk CCUS who opt for one year of treatment with Inqovi or observation only. "Many patients feel anxious when given a CCUS diagnosis and information about AML risk," says Dr. Lachelle Weeks, Assistant Professor, Dana-Farber Cancer Institute and a clinician on the study. "There are a number of patients who want to do something about it, and this trial could be the first step." All patients will be observed for three years to assess the effects of Inqovi on AML progression and other health outcomes. "Patients with high-risk CCUS already have low blood counts, which can significantly affect their quality of life," said Dr. Chien. "We're also looking at whether treatment improves quality of life, stabilizes blood counts, or reduces the burden of comorbidities, like heart disease, that are sometimes associated with certain mutations." The trial will also assess mutational burden—whether the percentage of cells with mutations increases, decreases, or stays the same with treatment. A comparison of treated and untreated patients will provide insights into potential benefits of early intervention in CCUS. This trial aims to pave the way for future larger studies testing the efficacy of intervention as part of developing comprehensive AML prevention strategies. "The ultimate goal is to prevent diagnoses like AML altogether," Dr. Weeks notes. "This trial represents a critical step in understanding CCUS progression and exploring how early intervention could redefine care standards. If successful, it could spare patients and their families the profound challenges of living with and treating AML." Prioritizing Diversity in Cancer Research In addition to its scientific goals, this trial centers inclusivity in cancer research. By leveraging Break Through Cancer's model of radical collaboration and tapping into the broad reach of four disparate communities, this trial seeks to recruit a diverse and representative patient population and proactively circumvent long-standing inequities in cancer prevention research. "By recruiting from community sites and reflecting the demographics of our catchment areas, we're ensuring our findings benefit all populations at risk," says Dr. Weeks. To achieve this, the trial partners with community-based nurse navigators linked to Break Through Cancer's four partner sites. Together, researchers at Dana-Farber Cancer Institute, Memorial Sloan Kettering Cancer Center, Johns Hopkins Sidney Kimmel Comprehensive Cancer Center and MD Anderson are working to close gaps in care and improve outcomes for all patients. About the trial Title: Early Intervention in High Risk CCUS (NCT06802146) About Break Through Cancer Founded in 2021, Break Through Cancer empowers outstanding researchers and physicians to both intercept and find cures for several of the deadliest cancers by stimulating radical collaboration among outstanding cancer research institutions, including its founding partners: Dana-Farber Cancer Institute, Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Memorial Sloan Kettering Cancer Center, MIT's Koch Institute for Integrative Cancer Research, and The University of Texas MD Anderson Cancer Center. The Foundation is supported by a Board of Directors from the five partner institutions and a Scientific Advisory Board of U.S. cancer experts. The Foundation was launched with an extraordinary challenge pledge of $250 million from Mr. and Mrs. William H. Goodwin, Jr. and their family, and the estate of William Hunter Goodwin III. For further information, please visit the Foundation's website at . References Surveillance, Epidemiology, and End Results (SEER) Program. Cancer Stat Facts: Acute Myeloid Leukemia (AML). Weeks LD, Ebert BL. Causes and consequences of clonal hematopoiesis. Blood. 2023;142(26):2235-2245. Savona M, Bewersdorf JP, Allen SL, et al. FDA approval summary: decitabine and cedazuridine tablets for myelodysplastic syndromes. Clin Cancer Res. 2022;28(16):3411-3414. Media Contact: Soracha Ward [email protected] SOURCE Break Through Cancer WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

Clinical StudyDrug Approval

10 Jul 2025

·www.taiho.co.jp

Taiho Pharmaceutical and Taiho Oncology Announce U.S. FDA Acceptance of Supplemental New Drug Application for INQOVI® in Combination with Venetoclax to Treat Patients with Acute Myeloid Leukemia

The submission is based on clinical trial data demonstrating that INQOVI in combination with venetoclax met complete response endpoints; no new safety concerns were reported If approved, INQOVI in combination with venetoclax would be the first all-oral combination treatment for patients with newly diagnosed AML who are ineligible for intensive induction chemotherapy INQOVI is currently approved in the U.S. as a treatment for myelodysplastic syndromes and chronic myelomonocytic leukemia Taiho Pharmaceutical Co., Ltd. and its U.S. subsidiary, Taiho Oncology, Inc., announced today that the U.S. Food and Drug Administration (FDA) has accepted their supplemental new drug application (sNDA) for INQOVI (decitabine and cedazuridine) plus venetoclax as a treatment for adults with newly diagnosed acute myeloid leukemia (AML) who are ineligible for intensive induction chemotherapy. The FDA assigned a standard review with a Prescription Drug User Fee Act (PDUFA) target action date of February 25, 2026. The sNDA is supported by results from ASCERTAIN-V, a Phase 2b study of INQOVI plus venetoclax in 101 adult patients with newly diagnosed AML who were ineligible for intensive induction chemotherapy.1 INQOVI is an orally administrated hypomethylating regimen, currently indicated in the U.S. for the treatment of adults with myelodysplastic syndromes (MDS) and chronic myelomonocytic leukemia (CMML).2 Approximately 22,000 people in the U.S. will receive a diagnosis of AML, a cancer of the blood and bone marrow, in 2025.3 More than about half those patients will likely be deemed ineligible for intensive induction chemotherapy.4 “We have an unwavering dedication to developing innovative new cancer treatments, and the FDA’s acceptance of our sNDA for INQOVI in combination with venetoclax highlights the need for novel approaches in AML,” said Harold Keer, MD, PhD, Chief Medical Officer, Taiho Oncology. “If approved for patients with AML who are not eligible to undergo intensive induction chemotherapy, INQOVI in combination with venetoclax would offer the first all-oral alternative to current therapies.” In each 28-day treatment cycle, the patients received INQOVI on days one through five and venetoclax daily. Median follow-up period was 11.2 months. The trial met its primary endpoint with a complete response (CR) rate of 46.5% (n=47). In considering secondary endpoints, the study found that CR plus CR with incomplete hematologic recovery totaled 63.4% (n=64). Median overall survival was estimated to be 15.5 months. At 12 months, median duration of response had not been reached, and over 75% of patients achieving CR status remained in CR. No new safety concerns were reported. Adverse events (AEs) of grade 3 and higher were reported in 98% of patients (n=99); most commonly, febrile neutropenia (49.5%), anemia (38.6%) and neutropenia (35.6%) were reported. No drug-drug interactions were observed between INQOVI and venetoclax. At 30 and 60 days after the first dose of INQOVI, deaths attributed to either AEs or disease progression totaled 3% (n=3) and 9.9% (n=10) of study participants, respectively. Results were presented at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting and the 2025 European Hematology Association (EHA) Congress. ※ASCERTAIN-V Study: AStx727-07: decitabine + CEdazuRidine TreAtment IN AML, adding Venetoclax This product is an orally administered, fixed dose combination of the anti-cancer DNA hypomethylating agent decitabine, approved in the U.S., together with cedazuridine,5 an inhibitor of cytidine deaminase.6 By inhibiting cytidine deaminase in the gut and the liver, the fixed dose combination is designed to allow for oral delivery of decitabine over five days in a given cycle to achieve comparable systemic exposure to IV decitabine administered over five days. Taiho Pharmaceutical, a subsidiary of Otsuka Holdings Co., Ltd. ( https://www.otsuka.com/en/ ), is an R&D-driven specialty pharma focusing on the fields of oncology and immune-related diseases. Its corporate philosophy takes the form of a pledge: “We strive to improve human health and contribute to a society enriched by smiles.” In the field of oncology, in particular, Taiho Pharmaceutical is known as a leading company in Japan for developing innovative medicines for the treatment of cancer, a reputation that is rapidly expanding through their extensive global R&D efforts. In areas other than oncology, as well, the company creates and markets quality products that effectively treat medical conditions and can help improve people’s quality of life. Always putting customers first, Taiho Pharmaceutical also aims to offer consumer healthcare products that support people’s efforts to lead fulfilling and rewarding lives. For more information about Taiho Pharmaceutical, please visit https://www.taiho.co.jp/en/ The mission of Taiho Oncology, Inc. is to improve the lives of patients with cancer, their families and their caregivers. The company specializes in the development and commercialization of orally administered anti-cancer agents for various tumor types. Taiho Oncology has a robust pipeline of small-molecule clinical candidates targeting solid-tumor and hematological malignancies, with additional candidates in pre-clinical development. Taiho Oncology is a subsidiary of Taiho Pharmaceutical Co., Ltd. which is part of Otsuka Holdings Co., Ltd. Taiho Oncology is headquartered in Princeton, New Jersey and oversees its parent company’s European and Canadian operations, which are located in Baar, Switzerland and Oakville, Ontario, Canada. For more information, visit https://www.taihooncology.com/, and follow us on LinkedIn and X.

Clinical ResultASCONDAPhase 2Drug Approval

100 Deals associated with Decitabine

External Link

KEGG	Wiki	ATC	Drug Bank
D03665	Decitabine	L01BC08	DB01262

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Acute Myeloid Leukemia	China	Pharmachemie BV	28 Sep 2008
Anemia, Refractory	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Anemia, Refractory, With Excess of Blasts	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Chronic Myelomonocytic Leukemia	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Refractory cytopenia with multilineage dysplasia and ringed sideroblasts	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Myelodysplastic Syndromes	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Secondary Myelodysplastic Syndrome	Phase 3	United States	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Austria	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Canada	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Czechia	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	France	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Germany	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Hungary	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Italy	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Spain	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	United Kingdom	Astex Pharmaceuticals, Inc.	15 Feb 2018

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


NCT02269280 (PF629, CTgov)	Phase 2	Chronic Myelomonocytic Leukemia \| Leukemia \| Myelodysplastic Syndromes	185	AZA+Azacitidine (Azacitidine (AZA) - Days 1 - 3)	sspyukqikh(olujvtyoht) = kfxsxtquzo ztonxofxjq (iraixcpdkp, pzkdgaydkr - jpdtezwljh) View more	-	07 Aug 2025
				Azacitidine (AZA) Days 1 - 5 (Azacitidine (AZA) - Days 1 - 5)	sspyukqikh(olujvtyoht) = opurruxdgm ztonxofxjq (iraixcpdkp, lsawzzbljc - rnssshnyho) View more
NCT05184842 (ASCO2025)	Phase 2	Myelodysplastic Syndromes TP53 mutation	40	Decitabine 0.2 mg/kg + Venetoclax 400 mg	nxxrqlgogi(csymykzphj) = qerkirxhzd mkxbsjwvqc (cdfodgsppm ) View more	Positive	30 May 2025
EHA2025	Not Applicable	Precursor T-Cell Lymphoblastic Leukemia-Lymphoma	3	Decitabine	evhhvbfmyp(vgghnmjkgv) = hnaeostgxo yeuldngvcx (qcyqqxbabf )	Positive	14 May 2025
				Decitabine+Dexamethasone	evhhvbfmyp(vgghnmjkgv) = jvsqkmnwjv yeuldngvcx (qcyqqxbabf )
PF526 (EHA2025)	Not Applicable	Acute Myeloid Leukemia First line DNA methylation heterogeneity	94	Decitabine (High LPMD)	oqgzdhwtus(vgixmfkiro) = ozzewdaznt vrabrditii (iqpphgyowc ) View more	Positive	14 May 2025
				Decitabine (Low LPMD)	oqgzdhwtus(vgixmfkiro) = jbockozakv vrabrditii (iqpphgyowc ) View more
NCT04087967 (DECITABINE COMBINED WITH HAAG, EHA2025)	Phase 3	Acute Myeloid Leukemia First line	33	Decitabine 20 mg/m²/d IV	lfkadvoart(irooorcbzf) = apnqecyuuk xdtytodmmy (nhwuigcycr ) View more	Positive	14 May 2025
				Idarubicin 12 mg/m²/d IV	lfkadvoart(irooorcbzf) = tnilxjnfkd xdtytodmmy (nhwuigcycr ) View more
EHA2025	Not Applicable	HCT-CI \| TP53 mutation	104	RTC containing decitabine	slfnecvela(pleudbsaku) = vzdlzaeimk dfsrzedatu (ocumjesxun ) View more	Positive	14 May 2025
				Modified BUCY regimen	slfnecvela(pleudbsaku) = cihksrznlk dfsrzedatu (ocumjesxun ) View more
NCT02269280 (PF629, EHA2025)	Phase 2	Myelodysplastic Syndromes ASXL1 \| RUNX1 \| TP53	241	3-day Decitabine (DAC3)	gvveqfalcb(wimdmsnyfd) = htbplgddof wstyzxmirs (skuthnyeep ) View more	Positive	14 May 2025
				3-day Azacitidine (AZA3)	gvveqfalcb(wimdmsnyfd) = yojylqjekz wstyzxmirs (skuthnyeep ) View more
PB2484 (EHA2025)	Not Applicable	Acute Myeloid Leukemia	114	Standard Treatment Group (IA regimen)	eunqdlhmhx(fmqbnczdbp) = dvwrmaskmj fmldntpuoa (dpjcapuogf ) View more	Positive	14 May 2025
				Standard Treatment Group (DA regimen)	eunqdlhmhx(fmqbnczdbp) = aiwusmftns fmldntpuoa (dpjcapuogf ) View more
PS2090 (EHA2025)	Not Applicable	GATA2 Deficiency Maintenance SETBP1 \| ASXL1	9	Decitabine-augmented myeloablative conditioning	rnjxkqimcs(ztmhvoreak) = qvwgmqewod labnbszmva (scdhwoyjkl )	Positive	14 May 2025
PS1526 (EHA2025)	Not Applicable	Acute Myeloid Leukemia	98	Azacytidine plus Venetoclax	zhfhusglbx(qcwfumphlm) = htvkhpfkqz bviyultucx (qbegikdqyp ) View more	Positive	14 May 2025
				Twice weekly low dose Decitabine plus Venetoclax	zhfhusglbx(qcwfumphlm) = xruzpsdmby bviyultucx (qbegikdqyp ) View more

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

AI Agents Built for Biopharma Breakthroughs

Accelerate discovery. Empower decisions. Transform outcomes.

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis