RegulationBreakthrough Therapy (US), Accelerated Approval (US), Orphan Drug (US), Orphan Drug (EU), Special Review Project (CN), Orphan Drug (AU), Conditional marketing approval (CN)

Structure/Sequence

Molecular FormulaC45H50ClN7O7S

InChIKeyLQBVNQSMGBZMKD-UHFFFAOYSA-N

CAS Registry1257044-40-8

688

Clinical Trials associated with Venetoclax

NCT06522386

/ Not yet recruitingPhase 2IIT

GATE1: A Multicenter Phase II Study of Pirtobrutinib, Rituximab and Venetoclax Combination Therapy for Patients With Previously Untreated Mantle Cell Lymphoma

Primary Objectives:
To estimate the percent of participants who achieve a best response of complete response by the end of the PRV combination therapy in the induction therapy phase in patients with previously untreated MCL.

Start Date01 Dec 2025

Sponsor / Collaborator

The University of Texas MD Anderson Cancer Center

NCT06445907

/ Not yet recruitingPhase 1IIT

Phase I Study of Q702 With Azacitidine and Venetoclax for Relapsed or Refractory Acute Myeloid Leukemia

To learn about the safety and tolerability of the drug combination of Q702, azacitidine, and venetoclax when given to participants with relapsed/refractory AML.

Start Date29 Nov 2025

Sponsor / Collaborator

The University of Texas MD Anderson Cancer Center

[+1]

NCT06763341

/ Not yet recruitingPhase 1IIT

A Phase 1/1b Study of AOH1996 Alone or in Combination With the BCL-2 Inhibitor Venetoclax +/- Azacitidine in Patients With Relapsed/Refractory Acute Myeloid Leukemia

This phase I trial tests safety, side effects, and best dose of AOH1996 alone or in combination with venetoclax with or without azacitidine for the treatment of patients with acute myeloid leukemia (AML) that has come back after a period of improvement (relapsed) or AML that has not responded to previous treatment (refractory). AOH1996 is in a class of medications called PCNA inhibitors. It inhibits cancer growth and induces deoxyribonucleic acid (DNA) damage. This may help keep cancer cells from growing and damage cancer cell DNA. Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking BCL-2, a protein needed for cancer cell survival. Azacitidine is in a class of medications called demethylation agents. It works by helping the bone marrow to produce normal blood cells and by killing abnormal cells in the bone marrow. Giving AOH1996 alone or in combination with venetoclax with or without azacitidine may be safe, tolerable and/or effective in treating patients with AML.

Start Date16 Aug 2025

Sponsor / Collaborator

City of Hope National Medical Center

[+1]

100 Clinical Results associated with Venetoclax

100 Translational Medicine associated with Venetoclax

100 Patents (Medical) associated with Venetoclax

3,573

Literatures (Medical) associated with Venetoclax

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

01 Dec 2025·Blood Research

Relative efficacy of systemic treatments for patients with relapsed/refractory chronic lymphocytic leukemia: a network meta-analysis according to 17p deletion/TP53 mutations

Article

Author: Lim, Joo Han ; Kim, Jinchul ; Lee, Moon Hee ; Cho, Jinhyun

Abstract:

Purpose:

This network meta-analysis aimed to evaluate the relative efficacy of systemic treatments in patients with relapsed/refractory chronic lymphocytic leukemia (R/R CLL), focusing on key genetic mutations, specifically the 17p deletion and TP53 mutations.

Methods:

We conducted a systematic literature review to identify all publicly available randomized controlled trials (RCTs) using PubMed, EMBASE, the Cochrane database, and meeting abstracts published through December 2023. A Bayesian network meta-analysis was performed to estimate the hazard ratios (HRs) for progression-free survival (PFS) with 95% confidence intervals (CIs) and to determine the ranking of the included regimens.

Results:

Twelve trials involving 4,437 patients and 13 treatment options were included in the meta-analysis. Venetoclax plus rituximab and zanubrutinib emerged as the most effective treatments for the overall R/R CLL population, showing the lowest PFS HR (HR 0.62, 95% CI 0.32–1.20 and HR 0.65, 95% CI 0.49–0.86, respectively) versus ibrutinib, and were ranked as the best agent (surface under the cumulative ranking curve [SUCRA] value of both 90%, respectively) among the included drugs. In the 17p deletion/TP53 mutation subgroup, zanubrutinib demonstrated the most favorable efficacy (HR 0.52, 95% CI 0.31–0.88 versus ibrutinib) with the highest SUCRA value (97%). In patients without these mutations, venetoclax plus rituximab was the most effective (HR 0.49, 95% CI 0.26–0.94 versus ibrutinib) with a SUCRA value of 94%.

Conclusion:

Our findings highlight the superior efficacy of venetoclax plus rituximab and zanubrutinib for treating R/R CLL and confirm that the role of each regimen may vary depending on the clinically significant mutations.

01 Dec 2025·CANCER CHEMOTHERAPY AND PHARMACOLOGY

Pharmacokinetic analysis of crushed venetoclax tablets combined with azacitizine for recurrent pediatric acute myeloid leukemia (AML)

Article

Author: Yasu, Takeo ; Yuza, Yuki ; Makimoto, Atsushi ; Matsui, Motohiro

BACKGROUND:

The efficacy of a combination therapy consisting of venetoclax (VEN) and azacytidine (AZA) for newly diagnosed acute myeloid leukemia (AML) has been confirmed in elderly patients. However, the clinical data on VEN for pediatric AML are limited. A combination therapy consisting of crushed VEN tablets and AZA (VEN/AZA) was administered to two children with recurrent AML. The pharmacokinetics of VEN were then analysed.

CASE PRESENTATION:

[Patient 1] A 1-year-old, male patient who experienced an AML relapse following an allogeneic hematopoietic stem cell transplantation received three courses of VEN/AZA. At the initial dosage of VEN (8 mg/kg), the minimum plasma concentration (C_min) was only 0.44 µg/ml, which was far less than the optimal C_min of 1.2 µg/ml. Subsequent dose-escalation to 10 mg/kg only achieved C_min 0.42 µg/ml. [Patient 2] A 3-year-old, female patient in whom infantile acute lymphoblastic leukemia was originally diagnosed experienced a recurrence in the form of AML after lineage-switching. Three courses of VEN/AZA were administered with the same therapeutic drug monitoring as in Case 1. The C_min of VEN was 0.15 µg/ml at 8 mg/kg. Afterwards, voriconazole 16 mg/kg/day was begun for a concomitant fungal infection together with VEN 2 mg/kg. This combination finally achieved C_min 1.14 µg/ml probably through CYP3A4 inhibition by voriconazole. In terms of safety, only grade 4 hematological adverse events were observed in both patients. In terms of efficacy, patient 1 and patient 2 achieved stable disease status for two months and six months, respectively.

CONCLUSION:

Pediatric patients may scarcely achieve effective plasma concentration of VEN when crushed tablets are used at the same dosage as in adults.

842

News (Medical) associated with Venetoclax

15 Jan 2025

·www.accesswire.com

Aptevo\'s Peter Pavlik, PhD, Chairing Session on \"Bi and Multispecific Biologics\" at Cambridge Healthcare Institute\'s Pep Talk 2025

Also giving an in-session talk titled \"Modular Multispecific Biotherapeutics: Rapid Therapeutic Design with the ADAPTIR® Platform,\" showcasing Aptevo\'s drug engineering and rational drug design expertise SEATTLE, WA / ACCESSWIRE / January 15, 2025 / Aptevo Therapeutics (\"Aptevo\") (NASDAQ:APVO) today announced that Peter Pavlik, PhD, Senior Director of Protein Engineering, will chair a session titled \"Bi and Multispecific Biologics\" and present a talk,\"Modular Multispecific Biotherapeutics: Rapid Therapeutic Design with the ADAPTIR® Platform,\" at the Cambridge Healthcare Institute\'s Pep Talk conference today.DetailsSession Title: Bi and Multispecific BiologicsTalk Title: Modular Multispecific Biotherapeutics: Rapid Therapeutic Design with the ADAPTIR™ Platform (talk being given as part of this session)Session Chair and Talk Presenter: Peter Pavlik, PhDDate/Time: Wednesday, January 15th from 3:15-5:20 US Pacific time.About Dr. PavlikPeter Pavlik, PhD, serves as the Senior Director of Protein Engineering at Aptevo Therapeutics. In his career at Aptevo and previously MedImmune/AstraZeneca and Los Alamos National Labs, he has implemented novel technologies to streamline discovery of binding domains and their incorporation into stable and efficacious biotherapeutics. Dr. Pavlik has oversight over all processes currently used at Aptevo, which are optimized to multiple areas of drug development from target validation to antibody discovery to IND and to clinic. Dr. Pavlik has a unique understanding of the biopharma industry from the large and small company perspectives.About Aptevo TherapeuticsAptevo Therapeutics Inc. (NASDAQ:APVO) is a clinical-stage biotechnology company focused on developing novel bispecific immunotherapies for the treatment of cancer. The company has two clinical candidates. Mipletamig is currently being evaluated in RAINIER, a Phase 1b/2 trial for the treatment of frontline acute myeloid leukemia in combination with standard of care venetoclax + azacitidine. Mipletamig has orphan status for AML according to the Orphan Drug Act. ALG.APV-527, a bispecific conditional 4-1BB agonist, only active upon simultaneous binding to 4-1BB and 5T4, is being co-developed with Alligator Bioscience and is being evaluated in a Phase 1 clinical trial for the treatment of multiple solid tumor types likely to express 5T4. The Company has three pre-clinical candidates with different mechanisms of action designed to target a range of solid tumors. All pipeline candidates were created from two proprietary platforms, ADAPTIR® and ADAPTIR-FLEX®. The Aptevo mission is to improve treatment outcomes and transform the lives of cancer patients. For more information, please visit www.aptevotherapeutics.com.Safe Harbor StatementThis press release includes forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. All statements, other than statements of historical fact, including, without limitation, Aptevo\'s expectations regarding the effectiveness of its ADAPTIR® and ADAPTIR-FLEX® platform technologies and whether such technologies will accelerate drug discovery and development, statements related to the performance of Aptevo\'s drug candidates in the clinic and whether such performance will translate into improved patient outcomes, statements related to the progress of and enthusiasm for Aptevo\'s preclinical and clinical programs, statements related to Aptevo\'s ability to generate stockholder value, whether Aptevo will continue to have momentum in its business in the future, and any other statements containing the words \"may,\" \"believes,\" \"expects,\" \"potential,\" \"designed,\" \"engineered,\" \"innovative,\" \"initiate,\" \"allow,\" \"promise,\" \"plans,\" \"will\" and similar expressions are intended to identify forward-looking statements. These forward-looking statements are based on Aptevo\'s current intentions, beliefs, and expectations regarding future events. Aptevo cannot guarantee that any forward-looking statement will be accurate. Investors should realize that if underlying assumptions prove inaccurate or unknown risks or uncertainties materialize, actual results could differ materially from Aptevo\'s expectations. Investors are, therefore, cautioned not to place undue reliance on any forward-looking statement.There are several important factors that could cause Aptevo\'s actual results to differ materially from those indicated by such forward-looking statements, including a deterioration in Aptevo\'s business or prospects; further assessment of preliminary or interim data or different results from later clinical trials; adverse events and unanticipated problems, adverse developments in clinical development, including unexpected safety issues observed during a clinical trial; adverse developments in the U.S. or global capital markets, credit markets or economies generally; and changes in regulatory, social, macroeconomic, and political conditions. For instance, actual results may differ materially from those indicated by such forward-looking statements as a result of various important factors, including the uncertainties inherent in the initiation, enrollment and maintenance of patients in clinical trials, uncertainties inherent in the results of preliminary or interim data and preclinical and clinical studies being predictive of the results of later-stage clinical trials, the availability and timing of data from ongoing clinical trials, the trial design includes combination therapies that may make it difficult to accurately ascertain the benefits of mipletamig, expectations for the timing and steps required in the regulatory review process, expectations for regulatory approvals, the impact of competitive products, our ability to enter into agreements with strategic partners or raise funds on acceptable terms or at all and other matters that could affect the availability or commercial potential of the Company\'s product candidates, business or economic disruptions due to catastrophes or other events, including natural disasters or public health crises such as the novel coronavirus (referred to as COVID-19), geopolitical risks, including the current war between Russia and Ukraine as well as the war between Israel and Hamas, and macroeconomic conditions such as rising inflation and interests rates, increased market volatility and decreased consumer confidence. These risks are not exhaustive, Aptevo faces known and unknown risks. Additional risks and factors that may affect results are set forth in Aptevo\'s filings with the Securities and Exchange Commission, including its Annual Report on Form 10-K for the fiscal year ended December 31, 2023, and its subsequent reports on Form 10-Q and current reports on Form 8-K. The foregoing sets forth many, but not all, of the factors that could cause actual results to differ from Aptevo\'s expectations in any forward-looking statement. Any forward-looking statement speaks only as of the date of this press release, and, except as required by law, Aptevo does not assume any obligation to update any forward-looking statement to reflect new information, events, or circumstances.Aptevo TherapeuticsMiriam Weber MillerEmail: [email protected] or [email protected]Phone: 206-859-6629SOURCE: Aptevo TherapeuticsRelated Documents:

ImmunotherapyPhase 1Orphan Drug

15 Jan 2025

·aptevotherapeutics.gcs-web.com

Aptevo's Peter Pavlik, PhD, Chairing Session on "Bi and Multispecific Biologics" at Cambridge Healthcare Institute's Pep Talk 2025

Also giving an in-session talk titled "Modular Multispecific Biotherapeutics: Rapid Therapeutic Design with the ADAPTIR® Platform," showcasing Aptevo's drug engineering and rational drug design expertise SEATTLE, WA / ACCESSWIRE / January 15, 2025 / Aptevo Therapeutics ("Aptevo") (NASDAQ:APVO) today announced that Peter Pavlik, PhD, Senior Director of Protein Engineering, will chair a session titled "Bi and Multispecific Biologics" and present a talk,"Modular Multispecific Biotherapeutics: Rapid Therapeutic Design with the ADAPTIR® Platform," at the Cambridge Healthcare Institute's Pep Talk conference today. Details Session Title: Bi and Multispecific Biologics Talk Title: Modular Multispecific Biotherapeutics: Rapid Therapeutic Design with the ADAPTIR™ Platform (talk being given as part of this session) Session Chair and Talk Presenter: Peter Pavlik, PhD Date/Time: Wednesday, January 15th from 3:15-5:20 US Pacific time. About Dr. Pavlik Peter Pavlik, PhD, serves as the Senior Director of Protein Engineering at Aptevo Therapeutics. In his career at Aptevo and previously MedImmune/AstraZeneca and Los Alamos National Labs, he has implemented novel technologies to streamline discovery of binding domains and their incorporation into stable and efficacious biotherapeutics. Dr. Pavlik has oversight over all processes currently used at Aptevo, which are optimized to multiple areas of drug development from target validation to antibody discovery to IND and to clinic. Dr. Pavlik has a unique understanding of the biopharma industry from the large and small company perspectives. About Aptevo Therapeutics Aptevo Therapeutics Inc. (NASDAQ:APVO) is a clinical-stage biotechnology company focused on developing novel bispecific immunotherapies for the treatment of cancer. The company has two clinical candidates. Mipletamig is currently being evaluated in RAINIER, a Phase 1b/2 trial for the treatment of frontline acute myeloid leukemia in combination with standard of care venetoclax + azacitidine. Mipletamig has orphan status for AML according to the Orphan Drug Act. ALG.APV-527, a bispecific conditional 4-1BB agonist, only active upon simultaneous binding to 4-1BB and 5T4, is being co-developed with Alligator Bioscience and is being evaluated in a Phase 1 clinical trial for the treatment of multiple solid tumor types likely to express 5T4. The Company has three pre-clinical candidates with different mechanisms of action designed to target a range of solid tumors. All pipeline candidates were created from two proprietary platforms, ADAPTIR® and ADAPTIR-FLEX®. The Aptevo mission is to improve treatment outcomes and transform the lives of cancer patients. For more information, please visit www.aptevotherapeutics.com. Safe Harbor Statement This press release includes forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. All statements, other than statements of historical fact, including, without limitation, Aptevo's expectations regarding the effectiveness of its ADAPTIR® and ADAPTIR-FLEX® platform technologies and whether such technologies will accelerate drug discovery and development, statements related to the performance of Aptevo's drug candidates in the clinic and whether such performance will translate into improved patient outcomes, statements related to the progress of and enthusiasm for Aptevo's preclinical and clinical programs, statements related to Aptevo's ability to generate stockholder value, whether Aptevo will continue to have momentum in its business in the future, and any other statements containing the words "may," "believes," "expects," "potential," "designed," "engineered," "innovative," "initiate," "allow," "promise," "plans," "will" and similar expressions are intended to identify forward-looking statements. These forward-looking statements are based on Aptevo's current intentions, beliefs, and expectations regarding future events. Aptevo cannot guarantee that any forward-looking statement will be accurate. Investors should realize that if underlying assumptions prove inaccurate or unknown risks or uncertainties materialize, actual results could differ materially from Aptevo's expectations. Investors are, therefore, cautioned not to place undue reliance on any forward-looking statement. There are several important factors that could cause Aptevo's actual results to differ materially from those indicated by such forward-looking statements, including a deterioration in Aptevo's business or prospects; further assessment of preliminary or interim data or different results from later clinical trials; adverse events and unanticipated problems, adverse developments in clinical development, including unexpected safety issues observed during a clinical trial; adverse developments in the U.S. or global capital markets, credit markets or economies generally; and changes in regulatory, social, macroeconomic, and political conditions. For instance, actual results may differ materially from those indicated by such forward-looking statements as a result of various important factors, including the uncertainties inherent in the initiation, enrollment and maintenance of patients in clinical trials, uncertainties inherent in the results of preliminary or interim data and preclinical and clinical studies being predictive of the results of later-stage clinical trials, the availability and timing of data from ongoing clinical trials, the trial design includes combination therapies that may make it difficult to accurately ascertain the benefits of mipletamig, expectations for the timing and steps required in the regulatory review process, expectations for regulatory approvals, the impact of competitive products, our ability to enter into agreements with strategic partners or raise funds on acceptable terms or at all and other matters that could affect the availability or commercial potential of the Company's product candidates, business or economic disruptions due to catastrophes or other events, including natural disasters or public health crises such as the novel coronavirus (referred to as COVID-19), geopolitical risks, including the current war between Russia and Ukraine as well as the war between Israel and Hamas, and macroeconomic conditions such as rising inflation and interests rates, increased market volatility and decreased consumer confidence. These risks are not exhaustive, Aptevo faces known and unknown risks. Additional risks and factors that may affect results are set forth in Aptevo's filings with the Securities and Exchange Commission, including its Annual Report on Form 10-K for the fiscal year ended December 31, 2023, and its subsequent reports on Form 10-Q and current reports on Form 8-K. The foregoing sets forth many, but not all, of the factors that could cause actual results to differ from Aptevo's expectations in any forward-looking statement. Any forward-looking statement speaks only as of the date of this press release, and, except as required by law, Aptevo does not assume any obligation to update any forward-looking statement to reflect new information, events, or circumstances. Aptevo Therapeutics Miriam Weber Miller Email: IR@apvo.com or millerm@apvo.com Phone: 206-859-6629 SOURCE: Aptevo Therapeutics

Phase 1ImmunotherapyOrphan Drug

14 Jan 2025

·www.taihooncology.com

Taiho Oncology Announces Decitabine and Cedazuridine to Be Included in NIH Precision Medicine Trials

Drug combination part of next-generation trials targeting specific genetic mutations in patients with myelodysplastic syndromes and acute myeloid leukemia PRINCETON, New Jersey, January 14, 2025 — Taiho Oncology, Inc., a company developing and commercializing novel treatments for hematologic malignancies and solid tumors, announced today that oral decitabine and cedazuridine will be included in next-generation clinical trials for precision medicine treatments initiated by the National Cancer Institute (NCI), part of the National Institutes of Health (NIH). Announced by the NIH on Oct. 23, 2024, the Myeloid Malignancies Molecular Analysis for Therapy Choice, or myeloMATCH, trials will be sponsored by NCI and conducted by the NCI-funded National Clinical Trials Network. The myeloMATCH program is comprised of trials evaluating new treatment combinations that target cancer-driving genetic mutations in myelodysplastic syndromes (MDS) or acute myeloid leukemia (AML). Across the myeloMATCH program, patients will undergo rapid genetic testing of their tumors and then be matched to trials involving oral decitabine and cedazuridine, other studies within myeloMATCH or, if there are no other myeloMATCH targeted combination options for their cancer types, standard treatment. “The myeloMATCH program is designed to ensure patients with aggressive malignancies of the blood and bone marrow receive therapy directed at specific, identified abnormalities in a timely manner,” said Harold Keer, MD, PhD, Chief Medical Officer, Taiho Oncology. “We are excited to have oral decitabine and cedazuridine included in this innovative clinical trial program. The inclusion of all oral regimens in the setting of myeloid malignancies has the potential to produce practice-changing data and reduce the treatment burden that patients and their loved ones face.” Oral decitabine and cedazuridine will be included in two trials within the myeloMATCH program: A Phase 2 trial (ClinicalTrials.gov, NCT06577441) will compare oral decitabine and cedazuridine to the combination treatment of oral decitabine and cedazuridine and enasidenib in treating patients with higher-risk, IDH2-mutated MDS. The trial will compare the complete remission (CR) rate between the two study groups and assess other endpoints, including safety. A Phase 2 trial (ClinicalTrials.gov, NCT06672146) will compare oral decitabine and cedazuridine and venetoclax plus enasidenib compared to oral decitabine and cedazuridine and venetoclax alone for the treatment of older patients with newly diagnosed AML or younger patients who are unable to receive standard treatment, and who have a mutation in the IDH2 gene. The trial will evaluate safety and compare the rate of measurable residual disease (MRD) negative complete remission (CR), as well as other secondary endpoints. For more information about myeloMATCH and the sub-studies that are currently open, click here. About Taiho Oncology, Inc. The mission of Taiho Oncology, Inc. is to improve the lives of patients with cancer, their families and their caregivers. The company specializes in the development and commercialization of orally administered anti-cancer agents for various tumor types. Taiho Oncology has a robust pipeline of small molecule clinical candidates targeting solid tumor and hematological malignancies, with additional candidates in pre-clinical development. Taiho Oncology is a subsidiary of Taiho Pharmaceutical Co., Ltd. which is part of Otsuka Holdings Co., Ltd. Taiho Oncology is headquartered in Princeton, New Jersey and oversees its parent company’s European and Canadian operations, which are located in Baar, Switzerland and Oakville, Ontario, Canada. For more information, visit https://www.taihooncology.com/, and follow us on LinkedIn and X. Taiho Oncology Contact: Leigh Labrie (609) 664-9878 llabrie@taihooncology.com

Phase 2

100 Deals associated with Venetoclax

External Link

KEGG	Wiki	ATC	Drug Bank
D10679	Venetoclax	L01XX52	DB11581

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Chronic lymphocytic leukaemia refractory	JP	AbbVie LLC	20 Sep 2019
Recurrent Chronic Lymphoid Leukemia	JP	AbbVie LLC	20 Sep 2019
Small Lymphocytic Lymphoma	US	AbbVie, Inc.	08 Jun 2018
Adult Acute Myeloblastic Leukemia	EU	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	IS	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	LI	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	NO	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Acute Myeloid Leukemia	CA	AbbVie AS	31 Oct 2016
Chronic Lymphocytic Leukemia	US	AbbVie, Inc.	11 Apr 2016

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Tumor Lysis Syndrome	Phase 3	US	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	FR	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	GR	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	PR	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	RS	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	ES	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	TW	AbbVie, Inc.	05 Aug 2024
Relapsing acute myeloid leukemia	Phase 3	US	AbbVie, Inc.	01 Oct 2022
Relapsing acute myeloid leukemia	Phase 3	US	Genentech, Inc.	01 Oct 2022
Relapsing acute myeloid leukemia	Phase 3	JP	Genentech, Inc.	01 Oct 2022

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


NCT04477486 (CTgov)	Phase 2	Mantle-Cell Lymphoma	13	Ibrutinib+Venetoclax	justobotqt(nhjwofkvzn) = aavnrxryrq cetmuzkksq (lrruauihjt, nyglkoyupj - tprorbpbcu)	-	14 Jan 2025
NCT03709758 (ASH2024) Manual	Phase 1	Acute Myeloid Leukemia First line	44	Venetoclax + Daunorubicin + Cytarabine	rbbyatqqyi(jrjhwhsukq) = 100 mg/d venetoclax was the MTD for pts treated with consol ara-C at 3 gm/m2. yagpnztslz (ccsgjfndgk ) View more	Positive	09 Dec 2024
NCT03836261 (AMPLIFY, ASH2024) Manual	Phase 3	Chronic Lymphocytic Leukemia First line	867	Acalabrutinib + Venetoclax	kascrfiwxa(tgfejwkuyj) = opjlerhrqv siospbqbxe (nyflyvchow ) View more	Positive	09 Dec 2024
NCT03836261 (AMPLIFY, ASH2024) Manual	Phase 3	Chronic Lymphocytic Leukemia First line	867	Acalabrutinib + Venetoclax + Obinutuzumab	kascrfiwxa(tgfejwkuyj) = vejeluuinv siospbqbxe (nyflyvchow ) View more	Positive	09 Dec 2024
ASH2024 Manual	Phase 1	Non-Hodgkin Lymphoma	13	Loncastuximab tesirine + Venetoclax	ovafpjlarq(zhphiyqavn) = cldkhlujnb gdopkgtnft (cstpupszih ) View more	Positive	09 Dec 2024
ASH2024 Manual	Not Applicable	Chronic Lymphocytic Leukemia First line	-	Venetoclax + obinutuzumab (VO)	vcoqntezbw(gzmumwfipx) = obfpivnmlz kbbpkjhjid (layzzcxjye ) View more	Positive	09 Dec 2024
ASH2024 Manual	Not Applicable	Chronic Lymphocytic Leukemia First line	-	Bruton tyrosine kinase inhibitor (BTKi)	vcoqntezbw(gzmumwfipx) = tcsbqglmqh kbbpkjhjid (layzzcxjye ) View more	Positive	09 Dec 2024
NCT05996406 (ASH2024) Manual	Phase 2	Immunoglobulin Light-Chain Amyloidosis First line t(11;14)	29	Venetoclax + Dexamethasone	vhymgttqpp(smbwznqwwi) = nmxekyvfzn izopsylbbp (gingeloovp ) View more	Positive	09 Dec 2024
ASH2024 Manual	Phase 1/2	Mantle-Cell Lymphoma	36	Venetoclax 2IbrutinibPrednisoneObinutuzumabLenalidomide	erauvizmpl(xcqrqbnypo) = thrombocytopenia (14%), neutropenia (13%), and anemia (10%) xdfdzycbkx (vwhsmfkmkq ) View more	Positive	09 Dec 2024
ASH2024 Manual	Phase 1/2	Mantle-Cell Lymphoma	36	Venetoclax 4IbrutinibPrednisoneObinutuzumabLenalidomide		Positive	09 Dec 2024
ASH2024	Not Applicable	Acute Myeloid Leukemia	-	Frontline FLAG-Ida Venetoclax	etioikgbgs(tzczonrnqm) = tvgaphasuz wzdjxhmcxt (yvrtfjvory ) View more	-	09 Dec 2024
ASH2024	Not Applicable	Acute Myeloid Leukemia	-	S227928	xxlztuknrz(gurlzgyrvo) = significantly reduced in BAX/BAK or CD74 deficient cells, confirming a mitochondrial apoptosis mechanism specific to CD74 expressing cells kbzbkndudz (lgsodjyrsl ) View more	-	09 Dec 2024
ASH2024	Not Applicable	Immunoglobulin Light-Chain Amyloidosis	-	Venetoclax monotherapy	vxqstjuath(qtgqybhwyr) = Gr3 pszsyawise (kdgzanvdeu ) View more	-	09 Dec 2024
ASH2024	Not Applicable	Immunoglobulin Light-Chain Amyloidosis	-	Venetoclax with low dose dexamethasone		-	09 Dec 2024

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

Chat with Hiro

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis