RegulationAccelerated Approval (United States), Orphan Drug (United States), Orphan Drug (European Union), Conditional marketing approval (China), Special Review Project (China), Orphan Drug (Australia), Breakthrough Therapy (United States)

Structure/Sequence

Molecular FormulaC45H50ClN7O7S

InChIKeyLQBVNQSMGBZMKD-UHFFFAOYSA-N

CAS Registry1257044-40-8

711

Clinical Trials associated with Venetoclax

NCT06672146

/ RecruitingPhase 2IIT

A Randomized Phase II Trial of ASTX727 and Venetoclax Compared With ASTX727, Venetoclax, and Enasidenib for Newly Diagnosed Older Adults With IDH2 Mutant Acute Myeloid Leukemia: A MyeloMATCH Substudy

This phase II MyeloMATCH treatment trial studies how well ASTX727 and venetoclax plus enasidenib works compared to ASTX727 and venetoclax alone for the treatment of older patients with newly diagnosed acute myeloid leukemia (AML) or younger patients who are considered unfit for standard treatment, and who have an abnormal change (mutation) in the IDH2 gene. This gene mutation can cause AML to grow and spread. This trial is being done to see if adding enasidenib to the usual treatment can help more patients with the IDH2 gene get rid of AML. Cedazuridine is in a class of medications called cytidine deaminase inhibitors. It prevents the breakdown of decitabine, making it more available in the body so that decitabine will have a greater effect. Decitabine is in a class of medications called hypomethylation agents. It works by helping the bone marrow produce normal blood cells and by killing abnormal cells in the bone marrow. Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking Bcl-2, a protein needed for cancer cell survival. Enasidenib works by stopping the growth and spread of tumor cells that have the IDH2 mutation. Giving ASTX727 and venetoclax plus enasidenib may work better in treating AML patients with the IDH2 mutation.

Start Date27 Dec 2025

Sponsor / Collaborator

National Cancer Institute

NCT06917911

/ Not yet recruitingPhase 2IIT

Phase II Study of Cytarabine + Daunorubicin (7 + 3) + Gemtuzumab Ozogamicin vs. Cytarabine + Daunorubicin (7 + 3) + Venetoclax for the Treatment of Newly Diagnosed Core Binding Factor Acute Myeloid Leukemia (CBF-AML) in Younger Adults: A MyeloMATCH Substudy

This phase II MyeloMATCH treatment trial compares the effect of venetoclax to gemtuzumab ozogamicin, when given with cytarabine and daunorubicin ("7+3" regimen), for the treatment of patients with core binding factor acute myeloid leukemia (CBF-AML). Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking Bcl-2, a protein needed for cancer cell survival. Gemtuzumab ozogamicin is a monoclonal antibody, called gemtuzumab, linked to an antitumor antibiotic drug, called ozogamicin. Gemtuzumab is a form of targeted therapy because it attaches to specific molecules (receptors) on the surface of cancer cells, known as CD33 receptors, and delivers ozogamicin to kill them. Chemotherapy drugs, such as cytarabine and daunorubicin work in different ways to stop the growth of cancer cells either by killing the cells, by stopping them from dividing, or by stopping them from spreading. Giving venetoclax with cytarabine and daunorubicin may have fewer side effects and be as effective or better than the combination with gemtuzumab ozogamicin in treating patients with core binding factor AML.

Start Date20 Nov 2025

Sponsor / Collaborator

National Cancer Institute

NCT06763341

/ Not yet recruitingPhase 1IIT

A Phase 1/1b Study of AOH1996 Alone or in Combination With the BCL-2 Inhibitor Venetoclax +/- Azacitidine in Patients With Relapsed/Refractory Acute Myeloid Leukemia

This phase I trial tests safety, side effects, and best dose of AOH1996 alone or in combination with venetoclax with or without azacitidine for the treatment of patients with acute myeloid leukemia (AML) that has come back after a period of improvement (relapsed) or AML that has not responded to previous treatment (refractory). AOH1996 is in a class of medications called PCNA inhibitors. It inhibits cancer growth and induces deoxyribonucleic acid (DNA) damage. This may help keep cancer cells from growing and damage cancer cell DNA. Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking BCL-2, a protein needed for cancer cell survival. Azacitidine is in a class of medications called demethylation agents. It works by helping the bone marrow to produce normal blood cells and by killing abnormal cells in the bone marrow. Giving AOH1996 alone or in combination with venetoclax with or without azacitidine may be safe, tolerable and/or effective in treating patients with AML.

Start Date16 Aug 2025

Sponsor / Collaborator

City of Hope National Medical Center

[+1]

100 Clinical Results associated with Venetoclax

100 Translational Medicine associated with Venetoclax

100 Patents (Medical) associated with Venetoclax

5,074

Literatures (Medical) associated with Venetoclax

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

31 Dec 2025·CANCER BIOLOGY & THERAPY

Targeting the IKZF1/BCL-2 axis as a novel therapeutic strategy for treating acute T-cell lymphoblastic leukemia

Article

Author: Li, Jun ; Ye, Chunmei ; Li, Hui ; Li, Juan

OBJECTIVES:

Acute T-cell lymphoblastic leukemia (T-ALL) is a severe hematologic malignancy with limited treatment options and poor long-term survival. This study explores the role of IKZF1 in regulating BCL-2 expression in T-ALL.

METHODS:

CUT&Tag and CUT&Run assays were employed to assess IKZF1 binding to the BCL-2 promoter. IKZF1 overexpression and knockdown experiments were performed in T-ALL cell lines. The effects of CX-4945 and venetoclax, alone and in combination, were evaluated in vitro and in vivo T-ALL models.

RESULTS:

CUT&Tag sequencing identified IKZF1 binding to the BCL-2 promoter, establishing it as a transcriptional repressor. Functional assays demonstrated that IKZF1 overexpression reduced BCL-2 mRNA levels and increased repressive histone marks at the BCL-2 promoter, while IKZF1 knockdown led to elevated BCL-2 expression. CX-4945, a CK2 inhibitor, could reduced BCL-2 levels in T-ALL cells. Notably, knockdown of IKZF1 partially rescued the CX-4945-induced repression of BCL-2. These results underscore the CK2-IKZF1 signaling axis as a key regulator of BCL-2 expression. In vitro, CX-4945 enhanced the cytotoxicity of venetoclax, with the combination showing significant synergistic effects and increased apoptosis in T-ALL cell lines. In vivo studies with cell line-derived xenograft (CDX) and patient-derived xenograft (PDX) models demonstrated that CX-4945 and venetoclax combined therapy provided superior therapeutic efficacy, reducing tumor burden and prolonging survival compared to single-agent treatments.

CONCLUSIONS:

IKZF1 represses BCL-2 in T-ALL, and targeting the CK2-IKZF1 axis with CX-4945 and venetoclax offers a promising therapeutic strategy, showing enhanced efficacy and potential as a novel treatment approach for T-ALL.

01 Dec 2025·Blood Research

Relative efficacy of systemic treatments for patients with relapsed/refractory chronic lymphocytic leukemia: a network meta-analysis according to 17p deletion/TP53 mutations

Article

Author: Lim, Joo Han ; Kim, Jinchul ; Lee, Moon Hee ; Cho, Jinhyun

Abstract:

Purpose:

This network meta-analysis aimed to evaluate the relative efficacy of systemic treatments in patients with relapsed/refractory chronic lymphocytic leukemia (R/R CLL), focusing on key genetic mutations, specifically the 17p deletion and TP53 mutations.

Methods:

We conducted a systematic literature review to identify all publicly available randomized controlled trials (RCTs) using PubMed, EMBASE, the Cochrane database, and meeting abstracts published through December 2023. A Bayesian network meta-analysis was performed to estimate the hazard ratios (HRs) for progression-free survival (PFS) with 95% confidence intervals (CIs) and to determine the ranking of the included regimens.

Results:

Twelve trials involving 4,437 patients and 13 treatment options were included in the meta-analysis. Venetoclax plus rituximab and zanubrutinib emerged as the most effective treatments for the overall R/R CLL population, showing the lowest PFS HR (HR 0.62, 95% CI 0.32–1.20 and HR 0.65, 95% CI 0.49–0.86, respectively) versus ibrutinib, and were ranked as the best agent (surface under the cumulative ranking curve [SUCRA] value of both 90%, respectively) among the included drugs. In the 17p deletion/TP53 mutation subgroup, zanubrutinib demonstrated the most favorable efficacy (HR 0.52, 95% CI 0.31–0.88 versus ibrutinib) with the highest SUCRA value (97%). In patients without these mutations, venetoclax plus rituximab was the most effective (HR 0.49, 95% CI 0.26–0.94 versus ibrutinib) with a SUCRA value of 94%.

Conclusion:

Our findings highlight the superior efficacy of venetoclax plus rituximab and zanubrutinib for treating R/R CLL and confirm that the role of each regimen may vary depending on the clinically significant mutations.

999

News (Medical) associated with Venetoclax

15 hours ago

·www.prnewswire.com

Taiho Oncology to Share Data in Five Presentations, Including Two Oral Presentations, at the 2025 American Society of Clinical Oncology Annual Meeting

Two oral presentations of phase 2 study findings from novel treatment options: an all-oral decitabine-cedazuridine combination for AML and zipalertinib for NSCLC that harbors exon 20 insertion mutations Additional presentations to include real-world data on the safety and effectiveness of two approved regimens: trifluridine-tipiracil paired with bevacizumab for metastatic colorectal cancer and futibatinib for cholangiocarcinoma PRINCETON, N.J., April 23, 2025 /PRNewswire/ -- Taiho Oncology, Inc., a company developing and commercializing novel treatments for hematologic malignancies and solid tumors, announced today that it will present new data from five studies, including two oral presentations, at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting, to be held May 30 through June 3 at McCormick Place in Chicago. The oral presentations will feature data regarding ASTX727 (oral decitabine-cedazuridine), an agent approved for myelodysplastic syndromes (MDS), paired with venetoclax for the treatment of acute myeloid leukemia (AML) and the novel investigational drug candidate zipalertinib for the treatment of non-small cell lung cancer (NSCLC) harboring EGFR exon 20 insertion mutations. The company will also share data on three real-world studies of two FDA-approved therapies: trifluridine and tipiracil paired with bevacizumab for the later-line treatment of adult patients with metastatic colorectal cancer and futibatinib for the treatment of adult patients with previously treated, unresectable, locally advanced or metastatic intrahepatic cholangiocarcinoma. "ASCO provides an invaluable opportunity to bring together the leading minds in oncology and discuss emerging new therapies and our understanding of real-world outcomes of existing therapies," said Harold Keer, MD, PhD, Chief Medical Officer, Taiho Oncology. "Our data at ASCO will continue to demonstrate our unwavering commitment to meaningful innovation that can potentially improve the lives of patients with cancer, their families and their caregivers." Details about these presentations can be found below: Oral Presentations Title: Efficacy of zipalertinib in NSCLC patients with EGFR exon 20 insertion mutations who received prior platinum-based chemotherapy with or without amivantamab Abstract Number: 8503 Session Name: Lung Cancer – Non-Small Cell Metastatic Session Type: Oral Abstract Session Session Date: June 1, 2025 Presentation Time: 8 a.m. – 11 a.m. CDT Location: Arie Crown Theater | Live Stream Presenter: Helena A. Yu, MD, Memorial Sloan Kettering Cancer Center Title: An all-oral regimen of decitabine-cedazuridine (DEC-C) plus venetoclax (VEN) in patients (pts) with newly diagnosed acute myeloid leukemia (AML) ineligible for intensive induction chemotherapy: Results from a Phase 2 cohort of 101 pts Abstract Number: 6504 Session Name: Hematologic Malignancies—Leukemia, Myelodysplastic Syndromes, and Allotransplant Session Type: Oral Abstract Session Session Date: June 2, 2025 Presentation Time: 3 p.m. – 6 p.m. CDT Location: S100a | Live Stream Presenter: Amer Zeidan, MBBS, Yale Cancer Center Poster Presentation Title: Real-world treatment patterns and outcomes with trifluridine/tipiracil monotherapy or in combination with bevacizumab in metastatic colorectal cancer Abstract Number: 3580 Session Name: Gastrointestinal Cancer—Colorectal and Anal Session Type: Poster Presentation Session Date: May 31, 2025 Presentation Time: 9 a.m. – 12 p.m. CDT Location: Hall A - Posters and Exhibits | On Demand Presenter: Donald Richards, MD, PhD, of Texas Oncology Online Abstracts Title: Real-world Clinical Outcomes of Patients with Metastatic Colorectal Cancer (mCRC) Treated with Trifluridine-Tipiracil + Bevacizumab by Performance Status Abstract Number: E15606 Session Type: Publication Only Publication Date: May 22, 2025 Publication Time: 5 p.m. EDT Lead Author: Maliha Nusrat, MD, MS, Memorial Sloan Kettering Cancer Center Title: Real-World patient characteristics and treatment patterns among cholangiocarcinoma patients treated with FGFR inhibitors Abstract Number: E16262 Session Type: Publication Only Publication Date: May 22, 2025 Publication Time: 5 p.m. EDT Lead Author: Amit Mahipal, MD, University Hospitals Seidman Cancer Center and Case Comprehensive Cancer Center About Taiho Oncology, Inc. The mission of Taiho Oncology, Inc. is to improve the lives of patients with cancer, their families and their caregivers. The company specializes in the development and commercialization of orally administered anti-cancer agents for various tumor types. Taiho Oncology has a robust pipeline of small-molecule clinical candidates targeting solid-tumor and hematological malignancies, with additional candidates in pre-clinical development. Taiho Oncology is a subsidiary of Taiho Pharmaceutical Co., Ltd. which is part of Otsuka Holdings Co., Ltd. Taiho Oncology is headquartered in Princeton, New Jersey and oversees its parent company's European and Canadian operations, which are located in Baar, Switzerland and Oakville, Ontario, Canada. For more information, visit , and follow us on LinkedIn and X. Taiho Oncology and the Taiho Oncology logo are registered trademarks of Otsuka Holdings Co., Ltd. or its subsidiaries. Taiho Oncology Contact: Leigh Labrie (609) 664-9878 [email protected] SOURCE Taiho Oncology WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

Phase 2ASCODrug ApprovalClinical Result

23 Apr 2025

·ir.sellaslifesciences.com

SELLAS to Present at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting

NEW YORK, April 23, 2025 (GLOBE NEWSWIRE) -- SELLAS Life Sciences Group, Inc. (NASDAQ: SLS) (“SELLAS” or the “Company”), a late-stage clinical biopharmaceutical company focused on the development of novel therapies for a broad range of cancer indications, today announced that preclinical efficacy of SLS009 in ASXL1 mutated colorectal cancer lines will be presented at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting, to take place May 30- June 3, 2025 in Chicago, Illinois. Poster presentation details: Title: In vitro efficacy of CDK9 inhibitor tambiciclib (SLS009) in ASXL1 mutated colorectal cancer cell lines. Session Date and Time: Monday, June 2, 2025, 1:30 PM-4:30 PM CDT Session Title: Developmental Therapeutics—Molecularly Targeted Agents and Tumor Biology Location: Hall A - Posters and Exhibits Abstract #: 3121 Poster Board #: 436 The full text of the abstract will be released by ASCO on May 22, 2025, at 5:00 PM EDT on asco.org/abstracts. SLS009 is currently being investigated in a Phase 2 open-label, single-arm, multi-center study designed to evaluate the safety, tolerability, and efficacy of SLS009 in combination with venetoclax and azacitidine including AML patients with ASXL1 mutations. Initial clinical safety and efficacy data are available. In addition, the study aims to identify biomarkers for the target patient population and enrichment for further trials. For more information on the study, visit clinicaltrial.gov identifier NCT04588922. About SELLAS Life Sciences Group, Inc. SELLAS is a late-stage clinical biopharmaceutical company focused on the development of novel therapeutics for a broad range of cancer indications. SELLAS’ lead product candidate, GPS, is licensed from Memorial Sloan Kettering Cancer Center and targets the WT1 protein, which is present in an array of tumor types. GPS has the potential as a monotherapy and combination with other therapies to address a broad spectrum of hematologic malignancies and solid tumor indications. The Company is also developing SLS009 (tambiciclib) - potentially the first and best-in-class differentiated small molecule CDK9 inhibitor with reduced toxicity and increased potency compared to other CDK9 inhibitors. Data suggests that SLS009 demonstrated a high response rate in AML patients with unfavorable prognostic factors including ASXL1 mutation, commonly associated with poor prognosis in various myeloid diseases. For more information on SELLAS, please visit www.sellaslifesciences.com. Forward-Looking Statements This press release contains forward-looking statements. All statements other than statements of historical facts are “forward-looking statements,” including those relating to future events. In some cases, forward-looking statements can be identified by terminology such as “plan,” “expect,” “anticipate,” “may,” “might,” “will,” “should,” “project,” “believe,” “estimate,” “predict,” “potential,” “intend,” or “continue” and other words or terms of similar meaning. These statements include, without limitation, statements related to the GPS clinical development program, including the REGAL study and the timing of future milestones related thereto. These forward-looking statements are based on current plans, objectives, estimates, expectations, and intentions, and inherently involve significant risks and uncertainties. Actual results and the timing of events could differ materially from those anticipated in such forward-looking statements as a result of these risks and uncertainties, which include, without limitation, risks and uncertainties with oncology product development and clinical success thereof, the uncertainty of regulatory approval, and other risks and uncertainties affecting SELLAS and its development programs as set forth under the caption “Risk Factors” in SELLAS’ Annual Report on Form 10-K filed on March 20, 2025 and in its other SEC filings. Other risks and uncertainties of which SELLAS is not currently aware may also affect SELLAS’ forward-looking statements and may cause actual results and the timing of events to differ materially from those anticipated. The forward-looking statements herein are made only as of the date hereof. SELLAS undertakes no obligation to update or supplement any forward-looking statements to reflect actual results, new information, future events, changes in its expectations, or other circumstances that exist after the date as of which the forward-looking statements were made. Investor Contact Bruce Mackle Managing Director LifeSci Advisors, LLC SELLAS@lifesciadvisors.com

ASCOPhase 2

22 Apr 2025

·aptevotherapeutics.gcs-web.com

Aptevo Therapeutics Announces the Closing of $2.0 Million Registered Direct Offering Priced At-The-Market Under Nasdaq Rules

SEATTLE, WA / ACCESS Newswire / April 22, 2025 / Aptevo Therapeutics Inc. (Nasdaq:APVO) ("Aptevo" or the "Company"), a clinical-stage biotechnology company focused on developing novel immune-oncology therapeutics based on its proprietary ADAPTIR® and ADAPTIR-FLEX® platform technologies, announced the closing of its previously announced offering of 2,324,000 shares of the Company's common stock in a registered direct offering (the "offering") at a purchase price of $0.862 per share. Roth Capital Partners acted as the exclusive placement agent for the offering. Gross proceeds from the offering were approximately $2.0 million, before deducting the placement agent's fees and other estimated offering expenses payable by the Company. Aptevo intends to use the net proceeds from the offering for the continued clinical development of its product candidates, working capital, and other general corporate purposes. A shelf registration statement on Form S-3 (File No. 333-284969) relating to the shares of common stock to be issued in the registered direct offering was previously filed with the Securities and Exchange Commission (the "SEC") and is currently effective. The registered direct offering was made only by means of a prospectus, including a prospectus supplement, forming a part of the effective registration statement, relating to the registered direct offering that was filed with the SEC. Electronic copies of the final prospectus supplement and accompanying prospectus may be obtained, on the SEC's website at http://www.sec.gov or by contacting Roth Capital Partners, LLC at 888 San Clemente Drive, Newport Beach CA 92660, by phone at (800) 678-9147 or by email at rothecm@roth.com. This press release does not constitute an offer to sell, or the solicitation of an offer to buy, the shares of common stock, nor will there be any sale of the shares of common stock in any state or other jurisdiction in which such offer, solicitation or sale is not permitted. About Aptevo Therapeutics Aptevo Therapeutics Inc. is a clinical-stage biotechnology company focused on developing novel bispecific immunotherapies for the treatment of cancer. The company has two clinical candidates. Mipletamig is currently being evaluated in RAINIER, a Phase 1b/2 trial for the treatment of frontline acute myeloid leukemia in combination with standard-of-care venetoclax + azacitidine. Mipletamig has received orphan drug designation ("orphan status") for AML according to the Orphan Drug Act. ALG.APV-527, a bispecific conditional 4-1BB agonist, only active upon simultaneous binding to 4-1BB and 5T4, is being co-developed with Alligator Bioscience and is being evaluated in a Phase 1 clinical trial for the treatment of multiple solid tumor types likely to express 5T4. The Company has three pre-clinical candidates with different mechanisms of action designed to target a range of solid tumors. All pipeline candidates were created from two proprietary platforms, ADAPTIR® and ADAPTIR-FLEX® The Aptevo mission is to improve treatment outcomes and transform the lives of cancer patients. For more information, please visit www.aptevotherapeutics.com. Safe Harbor Statement This press release includes forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. All statements, other than statements of historical fact, including, without limitation, statements regarding the use of proceeds of the offering, and any other statements containing the words "may," "continue to," "believes," "expects," "optimism," "potential," "designed," "promising," "plans," "will" and similar expressions are intended to identify forward-looking statements. These forward-looking statements are based on Aptevo's current intentions, beliefs, and expectations regarding future events. Aptevo cannot guarantee that any forward-looking statement will be accurate. Investors should realize that if underlying assumptions prove inaccurate or unknown risks or uncertainties materialize, actual results could differ materially from Aptevo's expectations. Investors are, therefore, cautioned not to place undue reliance on any forward-looking statement. There are several important factors that could cause Aptevo's actual results to differ materially from those indicated by such forward-looking statements, including a deterioration in Aptevo's business or prospects; uncertainties related to market conditions, the satisfaction of customary closing conditions related to the offering, compliance with Nasdaq listing requirements, and changes in regulatory, social, macroeconomic, and political conditions. For instance, actual results may differ materially from those indicated by such forward-looking statements as a result of various important factors, including the uncertainties inherent in the results of preliminary data and preclinical studies being predictive of the results of later-stage clinical trials, initiation, enrollment and maintenance of patients, and the completion of clinical trials, the availability and timing of data from ongoing clinical trials, the trial design includes combination therapies that may make it difficult to accurately ascertain the benefits of mipletamig, expectations for the timing and steps required in the regulatory review process, expectations for regulatory approvals, the impact of competitive products, our ability to enter into agreements with strategic partners or raise funds on acceptable terms or at all and other matters that could affect the availability or commercial potential of Aptevo's product candidates, business or economic disruptions due to catastrophes or other events, including natural disasters or public health crises such as the coronavirus (referred to as COVID-19), geopolitical risks, including the current war between Russia and Ukraine, war between Israel and Hamas, and macroeconomic conditions such as economic uncertainty, rising inflation and interest rates, increased market volatility and decreased consumer confidence. These risks are not exhaustive, Aptevo faces known and unknown risks. Additional risks and factors that may affect results are set forth in Aptevo's filings with the Securities and Exchange Commission, including its Annual Report on Form 10-K for the fiscal year ended December 31, 2024, and its subsequent current reports on Form 8-K. The foregoing sets forth many, but not all, of the factors that could cause actual results to differ from Aptevo's expectations in any forward-looking statement. Any forward-looking statement speaks only as of the date of this press release, and, except as required by law, Aptevo does not assume any obligation to update any forward-looking statement to reflect new information, events, or circumstances. CONTACT: Miriam Weber Miller Aptevo Therapeutics Email: IR@apvo.com or Millerm@apvo.com Phone: 206-859-6628 SOURCE: Aptevo Therapeutics

ImmunotherapyPhase 1Orphan Drug

100 Deals associated with Venetoclax

External Link

KEGG	Wiki	ATC	Drug Bank
D10679	Venetoclax	L01XX52	DB11581

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Mantle cell lymphoma recurrent	Japan	AbbVie LLC	27 Mar 2025
Mantle cell lymphoma refractory	Japan	AbbVie LLC	27 Mar 2025
Chronic lymphocytic leukaemia refractory	Japan	AbbVie LLC	20 Sep 2019
Recurrent Chronic Lymphoid Leukemia	Japan	AbbVie LLC	20 Sep 2019
Small Lymphocytic Lymphoma	United States	AbbVie, Inc.	08 Jun 2018
Adult Acute Myeloblastic Leukemia	European Union	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Iceland	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Liechtenstein	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Norway	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Acute Myeloid Leukemia	Canada	AbbVie AS	31 Oct 2016
Chronic Lymphocytic Leukemia	United States	AbbVie, Inc.	11 Apr 2016

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Tumor Lysis Syndrome	Phase 3	United States	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Australia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	France	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Greece	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Puerto Rico	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Serbia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Spain	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Taiwan Province	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	United Kingdom	AbbVie, Inc.	05 Aug 2024
Relapsing acute myeloid leukemia	Phase 3	United States	AbbVie, Inc.	01 Oct 2022

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


NCT04487106 (CTgov)	Phase 2	Relapsing acute myeloid leukemia \| Recurrent Acute Leukemia \| Chronic Myelomonocytic Leukemia ... View more	21	Trametinib+Venetoclax+Azacitidine (Cohort A (Newly Diagnosed AML Patients))	pxljonuvuv = rveuhzeudo igsdhhvsqb (nxzfmiljmi, yzmzoivekh - fhzpkbfcdk) View more	-	22 Apr 2025
				Trametinib+Venetoclax+Azacitidine (Cohort B (Relapsed/Refractory AML or Higher-risk MDS or CMML Patients))	pxljonuvuv = vnvwlzcngq igsdhhvsqb (nxzfmiljmi, wwcdrmiyza - lfrmbylmfn) View more
NCT05211336 (CTgov)	Phase 1	Refractory Diffuse Large B-Cell Lymphoma Activated B-Cell Type \| Diffuse Large B-Cell Lymphoma \| Primary Central Nervous System Lymphoma	14	Lenalidomide+Nivolumab+Ibrutinib+Prednisone+Venetoclax+Obinutuzumab (Lenalidomide+Nivolumab Followed by Venetoclax, Ibrutinib,Prednisone, Obinutuzumab, Lenalidomide-Nivo)	dbynfecwwi = mlsullnaie xlplmuqqvq (dnbvsicxsd, isiquyzzww - dfkdnadtzh) View more	-	20 Apr 2025
				Lenalidomide+VIPOR+Ibrutinib+Prednisone+Venetoclax+Obinutuzumab (Cohort 1, Arm 2: Experimental- VIPOR (Venetoclax, Ibrutinib, Prednisone, Obinutuzumab, Lenalidomide))	dbynfecwwi = lfcqwmzgxp xlplmuqqvq (dnbvsicxsd, xczcuhjyan - ofksolfksb) View more
NCT04285567 (CRISTALLO, CTgov)	Phase 3	Chronic Lymphocytic Leukemia	166	VEN (Arm A: VEN+G)	qtnlepcjwl = whvkpgxdbu jeqrgfrlwm (cdupfoyaem, syudqsqwgv - cfgjejrmqx) View more	-	17 Apr 2025
				bendamustine+fludarabine+cyclophosphamide+rituximab (Arm B: FCR/BR)	qtnlepcjwl = zywtxgdoqo jeqrgfrlwm (cdupfoyaem, abyxzkwokd - fgxulzjhfs) View more
NCT02942290 (Pubmed \| Blood)	Phase 1	High Risk Myelodysplastic Syndrome	107	Venetoclax 400 mg	wunpaxptyg(bvfkfkuufk) = qwrruwptaz vklpgbvbfe (cgovxdvhza ) View more	Positive	13 Mar 2025
NCT03236857 (Pubmed \| Pediatr Blood Cancer)	Phase 1	Recurrent Childhood Acute Lymphoblastic Leukemia	-	Venetoclax monotherapy	pogkeqwvtn(ledbjnosea) = One fatal adverse event possibly related to venetoclax occurred sacjyhebdk (qqnifuqnij ) View more	Positive	10 Mar 2025
NCT03214562 (Pubmed \| Leukemia)	Phase 1/2	Refractory acute myeloid leukemia wild-type TP53 status	138	FLAG-IDA + Venetoclax	icwjokcamp(hgfosvfhhj) = low foesxntpfv (eudhqjusme ) View more	Positive	25 Feb 2025
NCT03836261 (NEWS \| Pubmed) Manual	Phase 3	Chronic Lymphocytic Leukemia First line	867	Acalabrutinib-Venetoclax	tqytrwyjje(ylnjvdlgso) = dqfggfzmaa qegcridxwt (nvyvocgpnh ) View more	Positive	21 Feb 2025
				Acalabrutinib-Venetoclax-Obinutuzumab	tqytrwyjje(ylnjvdlgso) = vhfosetbvd qegcridxwt (nvyvocgpnh ) View more
NCT03319901 (Pubmed \| Blood Adv)	Phase 1	Acute Lymphoblastic Leukemia hypodiploid TP53-mutated	19	Venetoclax + Mini-HCVD	ynpavkrjht(kyirnocsaz) = zjmahxxsej rrpgwmgjnb (vgxtmlnuba, 71 - 100) View more	Positive	11 Feb 2025
NCT04599634 (CTgov)	Phase 1	Follicular Lymphoma \| Mantle-Cell Lymphoma \| Chronic Lymphocytic Leukemia ... View more	11	venetoclax+magrolimab+obinutuzumab (Arm 1, Cohort 1 Follicular Lymphoma Level 1)	nkzxunfvmq = afivppxayp gmdrtzyaji (lbpmelzmyl, afhkdepmto - sbadybhpuh) View more	-	04 Feb 2025
				venetoclax+magrolimab+obinutuzumab (Arm 2, Cohort 2 Marginal Zone Lymphoma, Mantle Cell Lymphoma, & Chronic Lymphocytic Leukemia Level 1)	nkzxunfvmq = uufxwhdgek gmdrtzyaji (lbpmelzmyl, kmdxlfbknd - vrxsxnogeq) View more
NCT04477486 (CTgov)	Phase 2	Mantle cell lymphoma refractory	13	Ibrutinib+Venetoclax	mlrabfruzk = fkbbkoqhif wikyneowxi (mtjiibmshp, qcvtlpprji - udgwimwtff)	-	14 Jan 2025

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

Chat with Hiro

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis