RegulationAccelerated Approval (United States), Orphan Drug (United States), Orphan Drug (European Union), Conditional marketing approval (China), Special Review Project (China), Orphan Drug (Australia), Breakthrough Therapy (United States)

Structure/Sequence

Molecular FormulaC45H50ClN7O7S

InChIKeyLQBVNQSMGBZMKD-UHFFFAOYSA-N

CAS Registry1257044-40-8

709

Clinical Trials associated with Venetoclax

NCT06763341

/ Not yet recruitingPhase 1IIT

A Phase 1/1b Study of AOH1996 Alone or in Combination With the BCL-2 Inhibitor Venetoclax +/- Azacitidine in Patients With Relapsed/Refractory Acute Myeloid Leukemia

This phase I trial tests safety, side effects, and best dose of AOH1996 alone or in combination with venetoclax with or without azacitidine for the treatment of patients with acute myeloid leukemia (AML) that has come back after a period of improvement (relapsed) or AML that has not responded to previous treatment (refractory). AOH1996 is in a class of medications called PCNA inhibitors. It inhibits cancer growth and induces deoxyribonucleic acid (DNA) damage. This may help keep cancer cells from growing and damage cancer cell DNA. Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking BCL-2, a protein needed for cancer cell survival. Azacitidine is in a class of medications called demethylation agents. It works by helping the bone marrow to produce normal blood cells and by killing abnormal cells in the bone marrow. Giving AOH1996 alone or in combination with venetoclax with or without azacitidine may be safe, tolerable and/or effective in treating patients with AML.

Start Date16 Aug 2025

Sponsor / Collaborator

City of Hope National Medical Center

[+1]

NCT06311227

/ RecruitingPhase 2IIT

A Phase 2 Study of Venetoclax in Relapsed Classic or Variant Hairy Cell Leukemia

This phase II trial tests how well venetoclax works in treating patients with hairy cell leukemia that has come back after a period of improvement (relapsed). Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking Bcl-2, a protein needed for cancer cell survival.

Start Date15 May 2025

Sponsor / Collaborator

National Cancer Institute

NCT06852222

/ Not yet recruitingPhase 3

A Phase 3 Randomized, Double-Blind, Placebo-Controlled, Study of Bleximenib, Venetoclax and Azacitidine for the Treatment of Participants With Newly Diagnosed Acute Myeloid Leukemia Harboring KMT2A Rearrangements or NPM1 Mutations Who Are Ineligible for Intensive Chemotherapy

The purpose of this study is to assess how bleximenib and Venetoclax (VEN)+ Azacitidine (AZA) works as compared to placebo and VEN+AZA alone for the treatment of participants with Acute Myeloid Leukemia (AML).

Start Date02 May 2025

Sponsor / Collaborator

Janssen Research & Development LLC

100 Clinical Results associated with Venetoclax

100 Translational Medicine associated with Venetoclax

100 Patents (Medical) associated with Venetoclax

4,921

Literatures (Medical) associated with Venetoclax

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

31 Dec 2025·CANCER BIOLOGY & THERAPY

Targeting the IKZF1/BCL-2 axis as a novel therapeutic strategy for treating acute T-cell lymphoblastic leukemia

Article

Author: Li, Jun ; Ye, Chunmei ; Li, Hui ; Li, Juan

OBJECTIVES:

Acute T-cell lymphoblastic leukemia (T-ALL) is a severe hematologic malignancy with limited treatment options and poor long-term survival. This study explores the role of IKZF1 in regulating BCL-2 expression in T-ALL.

METHODS:

CUT&Tag and CUT&Run assays were employed to assess IKZF1 binding to the BCL-2 promoter. IKZF1 overexpression and knockdown experiments were performed in T-ALL cell lines. The effects of CX-4945 and venetoclax, alone and in combination, were evaluated in vitro and in vivo T-ALL models.

RESULTS:

CUT&Tag sequencing identified IKZF1 binding to the BCL-2 promoter, establishing it as a transcriptional repressor. Functional assays demonstrated that IKZF1 overexpression reduced BCL-2 mRNA levels and increased repressive histone marks at the BCL-2 promoter, while IKZF1 knockdown led to elevated BCL-2 expression. CX-4945, a CK2 inhibitor, could reduced BCL-2 levels in T-ALL cells. Notably, knockdown of IKZF1 partially rescued the CX-4945-induced repression of BCL-2. These results underscore the CK2-IKZF1 signaling axis as a key regulator of BCL-2 expression. In vitro, CX-4945 enhanced the cytotoxicity of venetoclax, with the combination showing significant synergistic effects and increased apoptosis in T-ALL cell lines. In vivo studies with cell line-derived xenograft (CDX) and patient-derived xenograft (PDX) models demonstrated that CX-4945 and venetoclax combined therapy provided superior therapeutic efficacy, reducing tumor burden and prolonging survival compared to single-agent treatments.

CONCLUSIONS:

IKZF1 represses BCL-2 in T-ALL, and targeting the CK2-IKZF1 axis with CX-4945 and venetoclax offers a promising therapeutic strategy, showing enhanced efficacy and potential as a novel treatment approach for T-ALL.

01 Dec 2025·Blood Research

Relative efficacy of systemic treatments for patients with relapsed/refractory chronic lymphocytic leukemia: a network meta-analysis according to 17p deletion/TP53 mutations

Article

Author: Lim, Joo Han ; Kim, Jinchul ; Lee, Moon Hee ; Cho, Jinhyun

Abstract:

Purpose:

This network meta-analysis aimed to evaluate the relative efficacy of systemic treatments in patients with relapsed/refractory chronic lymphocytic leukemia (R/R CLL), focusing on key genetic mutations, specifically the 17p deletion and TP53 mutations.

Methods:

We conducted a systematic literature review to identify all publicly available randomized controlled trials (RCTs) using PubMed, EMBASE, the Cochrane database, and meeting abstracts published through December 2023. A Bayesian network meta-analysis was performed to estimate the hazard ratios (HRs) for progression-free survival (PFS) with 95% confidence intervals (CIs) and to determine the ranking of the included regimens.

Results:

Twelve trials involving 4,437 patients and 13 treatment options were included in the meta-analysis. Venetoclax plus rituximab and zanubrutinib emerged as the most effective treatments for the overall R/R CLL population, showing the lowest PFS HR (HR 0.62, 95% CI 0.32–1.20 and HR 0.65, 95% CI 0.49–0.86, respectively) versus ibrutinib, and were ranked as the best agent (surface under the cumulative ranking curve [SUCRA] value of both 90%, respectively) among the included drugs. In the 17p deletion/TP53 mutation subgroup, zanubrutinib demonstrated the most favorable efficacy (HR 0.52, 95% CI 0.31–0.88 versus ibrutinib) with the highest SUCRA value (97%). In patients without these mutations, venetoclax plus rituximab was the most effective (HR 0.49, 95% CI 0.26–0.94 versus ibrutinib) with a SUCRA value of 94%.

Conclusion:

Our findings highlight the superior efficacy of venetoclax plus rituximab and zanubrutinib for treating R/R CLL and confirm that the role of each regimen may vary depending on the clinically significant mutations.

985

News (Medical) associated with Venetoclax

31 Mar 2025

·www.prnewswire.com

Curis Provides Fourth Quarter 2024 Business Update

FDA and EMA discussions completed to support a potential accelerated approval path in both US and EU Orphan Drug Designation for PCNSL granted in both US and EU Management to host conference call today at 8:30 a.m. ET LEXINGTON, Mass., March 31, 2025 /PRNewswire/ -- Curis, Inc. (NASDAQ: CRIS), a biotechnology company focused on the development of emavusertib (CA-4948), an orally available, small molecule IRAK4 inhibitor, today reported its business update and financial results for the quarter ended December 31, 2024. Operational Highlights Emavusertib (IRAK4 Inhibitor) TakeAim Lymphoma Curis successfully concluded meetings with both the U.S. Food and Drug Administration (FDA) and the Committee for Medicinal Products for Human Use of the European Medicines Agency (EMA) on the suitability of using the ongoing TakeAim Lymphoma study (NCT 03328078) to support a potential accelerated approval path in PCNSL. Curis also announced that emavusertib has been granted Orphan Drug Designation for PCNSL in both the US and Europe. Curis provided a data update for 27 patients enrolled in the ongoing TakeAim Lymphoma study in relapsed/refractory (R/R) PCNSL as of January 2, 2025 (data cutoff). In 20 BTKi-experienced patients: 13 patients had change in tumor burden data available as of data cutoff; 9 of these 13 patients demonstrated a reduction in tumor burden, including 6 objective responses, 4 complete responses (CR) and 2 partial responses (PR), with 3 of 4 CRs lasting more than six months. In 7 BTKi-naïve patients: 6 patients had change in tumor burden data available as of data cutoff; 5 of these 6 patients demonstrated a reduction in tumor burden, including 5 objective responses, 1 CR and 4 PRs. TakeAim Leukemia In December 2024, the Company announced data from the TakeAim Leukemia study (NCT 04278768) in R/R Acute Myeloid Leukemia (AML) at the 66th ASH annual meeting for 21 patients with a FLT3 mutation who had received fewer than 3 lines of prior therapy and were treated with emavusertib as monotherapy at the Recommended Phase 2 Dose (RP2D) of 300 mg BID. 19 patients were response-evaluable: 10 of 19 patients achieved objective response, including 6 CRs, 2 CRs with incomplete hematological recovery or partial hematological recovery (CRi/CRh) and 2 morphologic leukemia-free state (MLFS); 7 of the 10 objective responses were reported at the first assessment. 2 patients were not response-evaluable, as they discontinued treatment prior to first disease assessment (death occurred at Day 8 and Day 13, respectively). Ema-Ven-Aza Triplet Study in Frontline AML The Company initiated a Phase 1 clinical study of emavusertib in combination with venetoclax and azacitidine (ema-ven-aza) in frontline AML (CA-4948-104, 2023-505828-58). The study is currently being conducted in Spain, Germany, and Italy to assess the safety and tolerability of different dosing regimens by adding emavusertib to a patient's ven-aza regimen after they have achieved a CR on ven-aza but remain positive for minimal residual disease. The first dosing cohort was completed and well tolerated, with no unexpected adverse events. As a result, the external Clinical Safety Review Committee recommended escalation to the next dosing cohort. Enrollment for this cohort is currently ongoing. Corporate On March 28, 2025, Curis priced a registered direct offering of common stock and concurrent private placement of pre-funded warrants and warrants ("March 2025 Offerings") with gross proceeds of approximately $10.0 million. The offerings are expected to close concurrently on March 31, 2025, subject to the satisfaction of customary closing conditions. In October 2024, Curis completed a registered direct offering and concurrent private placement with net proceeds of approximately $10.8 million. "Curis had a very productive 2024. We started the year seeing early responses in our PCNSL trial. As more patients enrolled, and we continued to see positive data, we initiated discussions with the FDA and EMA to discuss the possibility of pursuing an accelerated approval path for emavusertib. We are pleased to announce today that we have received supportive feedback from both agencies. Over the next 12-18 months, we will be focused on enrolling 30-40 additional patients to support the regulatory filing for accelerated approval," said James Dentzer, Chief Executive Officer of Curis. Additional details of the Company's discussions with EMA and FDA and the March 2025 Offerings were reported on Form 8-K filed by the Company with the SEC on March 28, 2025. Fourth Quarter 2024 Financial Results For the year ended December 31, 2024, Curis reported a net loss of $43.4 million, or $6.88 per share on both a basic and diluted basis, as compared to a net loss of $47.4 million, or $8.96 per share on both a basic and diluted basis in 2023. For the fourth quarter of 2024, Curis reported a net loss of $9.6 million or $1.25 per share on both a basic and diluted basis as compared to a net loss of $11.7 million or $2.03 on both a basic and diluted basis for the same period in 2023. Revenues, net were $10.9 million and $10.0 million for the years ended December 31, 2024 and 2023, respectively. Revenues are comprised of royalty revenues related to Genentech and Roche's net sales of Erivedge®. Revenues were $3.3 million and $2.7 million for the fourth quarters of 2024 and 2023, respectively. Research and development expenses were $38.6 million and $39.5 million for the years ended December 31, 2024 and 2023, respectively. The decrease was primarily attributable to lower clinical and consulting costs, partially offset by higher manufacturing costs. Research and development expenses were $9.0 million and $10.0 million for the fourth quarters of 2024 and 2023, respectively. General and administrative expenses were $16.8 million and $18.6 million for the years ended December 31, 2024 and 2023, respectively. The decrease was primarily attributable to lower consulting, legal, facility, insurance and employee-related costs. General and administrative expenses were $3.4 million and $4.9 million for the fourth quarters of 2024 and 2023, respectively. Other income, net was $1.2 million and $0.9 million for the years ended December 31, 2024 and 2023, respectively. The increase was attributable to a decrease in expense related to the sale of future royalties partially offset by a decrease in interest income. Other expense, net was $0.6 million for the fourth quarter of 2024 and other income, net was $0.5 million for the fourth quarter of 2023. As of December 31, 2024, Curis's cash and cash equivalents totaled $20.0 million, and the Company had approximately 8.5 million shares of common stock outstanding. Cash Runway Guidance Curis expects its cash and cash equivalents as of December 31, 2024, together with the expected proceeds from the March 2025 Offerings will enable the Company to fund its planned operations into the fourth quarter of 2025. Conference Call Information Curis management will host a conference call today, March 31, 2025, at 8:30 a.m. ET, to discuss the business update and these financial results. To access the live conference call, please dial (800)-836-8184 from the United States or (646)-357-8785 from other locations, shortly before 8:30 a.m. ET. The conference call can also be accessed here on the Curis website in the Investors section. About Curis, Inc. Curis is a biotechnology company focused on the development of emavusertib, an orally available, small molecule IRAK4 inhibitor. Emavusertib is currently being evaluated in the Phase 1/2 TakeAim Lymphoma study (CA-4948-101) in patients with relapsed/refractory primary central nervous system lymphoma (PCNSL) in combination with the BTK inhibitor ibrutinib, as a monotherapy in the Phase 1/2 TakeAim Leukemia study (CA-4948-102) in patients with relapsed/refractory acute myeloid leukemia (AML) and relapsed/refractory high risk myelodysplastic syndrome (hrMDS), and as a frontline combination therapy with venetoclax and azacitidine in patents with AML (CA-4948-104). Emavusertib has received Orphan Drug Designation from the U.S. Food and Drug Administration for the treatment of PCNSL, AML and MDS and from the European Commission for the treatment of PCNSL. Curis, through its 2015 collaboration with Aurigene, has the exclusive license to emavusertib (CA-4948). Curis licensed its rights to Erivedge® to Genentech, a member of the Roche Group, under which they are commercializing Erivedge® for the treatment of advanced basal cell carcinoma. For more information, visit Curis's website at . Cautionary Note Regarding Forward-Looking Statements: This press release contains forward-looking statements within the meaning of the U.S. Private Securities Litigation Reform Act of 1995, including, without limitation, statements concerning the offerings and the expected closing of the offerings; regulatory guidance on potential Conditional Marketing Authorization (CMA) from the EMA and potential NDA for Accelerated Approval from the FDA for emavusertib in the treatment of PCNSL, and Curis's expectations with respect to regulatory objectives; Curis's expectations with respect to enrollment of BTKi naïve and BTKi experienced populations in the TakeAim Lymphoma study; statements regarding updated PCNSL data from the TakeAim Lymphoma study, the potential use thereof for regulatory submissions to support CMA and/or Accelerated Approval, and the therapeutic potential and tolerability of emavusertib in patients with PCNSL; statements concerning research, development, clinical trials and commercialization plans, timelines, anticipated results, use, safety, efficacy, rates and duration of responses, mutations or potential biomarkers, and potential benefits of emavusertib as a monotherapy and/or as a combination therapy; statements regarding Curis's anticipated cash runway; and statements of assumptions underlying any of the foregoing. Forward-looking statements may contain the words "believes," "expects," "anticipates," "plans," "intends," "seeks," "estimates," "assumes," "predicts," "projects," "targets," "will," "may," "would," "could," "should," "likelihood", "continue," "potential," "opportunity," "focus," "strategy," "mission," or similar expressions. These forward-looking statements are not guarantees of future performance and involve risks, uncertainties, assumptions and other important factors that may cause actual results to be materially different from those indicated by such forward-looking statements. Customary closing conditions related to the offerings may not be satisfied. Curis may experience adverse results, delays and/or failures in its drug development programs and may not be able to successfully advance the development of its drug candidates in the time frames it projects, if at all. Curis's drug candidates may cause unexpected toxicities, fail to demonstrate sufficient safety and efficacy in clinical studies and/or may never achieve the requisite regulatory approvals needed for commercialization. Notably, Curis may not achieve its project timeline to fully enroll patients and submit regulatory filings for emavusertib within the next 18-24 months, and the safety and efficacy data results from the TakeAim Lymphoma study of emavusertib in PCNSL may not be sufficient for Curis to successfully achieve conditional marketing authorization from the EMA or accelerated approval from the FDA for emavusertib. Favorable results seen in preclinical studies and early clinical trials of Curis's drug candidates may not be replicated in later trials. Curis is dependent on the success of emavusertib and any delays in the development of emavusertib could have a material adverse effect on its business. There can be no guarantee that the collaboration agreement with Aurigene will continue for its full term, or the CRADA with NCI, that Curis or its collaborators will each maintain the financial and other resources necessary to continue financing its portion of the research, development and commercialization costs, or that the parties will successfully discover, develop or commercialize drug candidates under the collaboration. Regulatory authorities may determine to delay or restrict Genentech's and/or Roche's ability to continue to commercialize Erivedge in basal cell carcinoma. Competing drugs may be developed that are superior to Erivedge. In connection with its agreement with Oberland Capital, Curis faces risks relating to the transfer and encumbrance of certain royalty and royalty-related payments on commercial sales of Erivedge, including the risk that, in the event of a default by Curis or its wholly-owned subsidiary, Curis could lose all retained rights to future royalty and royalty-related payments, Curis could be required to repurchase such future royalty and royalty-related payments at a price that is a multiple of the payments it has received, and its ability to enter into future arrangements may be inhibited, all of which could have a material adverse effect on its business, financial condition and stock price. Curis will require substantial additional capital to fund its business. Based on its available cash resources, it does not have sufficient cash on hand to support current operations within the next 12 months from the date of this press release. Curis will require substantial additional funding in the immediate term to fund the development of emavusertib through regulatory approval and commercialization, and to support its continued operations. If it is not able to obtain sufficient funding, it will be forced to delay, reduce in scope or eliminate the development emavusertib, including related clinical trials and operating expenses, potentially delaying the time to market for, or preventing the marketing of, emavusertib, which could adversely affect its business prospects and its ability to continue operations, and would have a negative impact on its financial condition and its ability to pursue its business strategies. Curis faces substantial competition. Curis and its collaborators face the risk of potential adverse decisions made by the FDA, EMA and other regulatory authorities, investigational review boards, and publication review bodies. Curis may not obtain or maintain necessary patent protection and could become involved in expensive and time-consuming patent litigation and interference proceedings. Unstable market and economic conditions, natural disasters, public health crises, political crises and other events outside of Curis's control could significantly disrupt its operations or the operations of third parties on which Curis depends and could adversely impact Curis's operating results and its ability to raise capital. Other important factors that may cause or contribute to actual results being materially different from those indicated by forward-looking statements include the factors set forth under the captions "Risk Factor Summary" and "Risk Factors" in our most recent Form 10-K, and the factors that are discussed in other filings that we periodically make with the Securities and Exchange Commission. In addition, any forward-looking statements represent the views of Curis only as of today and should not be relied upon as representing Curis's views as of any subsequent date. Curis disclaims any intention or obligation to update any of the forward-looking statements after the date of this press release whether as a result of new information, future events or otherwise, except as may be required by law. SOURCE Curis, Inc. WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

Clinical ResultPhase 1Accelerated ApprovalOrphan DrugLicense out/in

28 Mar 2025

·www.globenewswire.com

Aptose Reports Year End 2024 Results and Corporate Highlights

Tuspetinib Triple Drug Frontline Therapy Advancing in TUSCANY Clinical Trial Results to Date Highlight TUS Potential as an Ideal Third Drug to Include in AML Triplet Therapy Aptose Signs Debt Conversion Agreement with Hanmi SAN DIEGO and TORONTO, March 28, 2025 (GLOBE NEWSWIRE) -- Aptose Biosciences Inc. (“Aptose” or the “Company”) (NASDAQ: APTO, TSX: APS), a clinical-stage precision oncology company developing a tuspetinib (TUS)-based triple drug frontline therapy to treat patients with newly diagnosed acute myeloid leukemia (AML), today announced financial results for the year ended December 31, 2024, and provided a corporate update. "During 2024 and into 2025, we continue to advance our lead investigational drug tuspetinib in combination with venetoclax (VEN) and azacitidine (AZA) for frontline treatment of newly diagnosed acute myeloid leukemia (AML),” said William G. Rice, Ph.D., Chairman, President and Chief Executive Officer of Aptose. “Tuspetinib brings favorable safety and broad activity across AML genetic subtypes to the TUS+VEN+AZA triplet therapy, which already has achieved complete remissions (CRs) in difficult-to-treat and underserved TP53-mutated/CK AML and FLT3-wildtype AML patients in our ongoing TUSCANY trial. We look forward to sharing more data as the trial evolves.” Key Corporate Highlights Tuspetinib Phase 1/2 TUSCANY Trial Well Under Way with Responses Noted - Tuspetinib based TUS+VEN+AZA triplet therapy is being advanced in the TUSCANY Phase 1/2 trial with the goal of creating an improved frontline therapy for newly diagnosed AML patients that is active across diverse AML populations (mutation agnostic triplet frontline therapy), including FLT3-wildtype AML. This activity differentiates TUS from other drugs in development. In January 2025, Aptose announced initiation of dosing in the first TUSCANY trial cohort with the starting dose of 40 mg TUS in combination with standard-of-care doses of VEN+AZA. At 40 mg TUS, the triplet therapy achieved complete remissions (CRs) in difficult-to-treat TP53-muated AML and FLT3-wildtype AML patients, including a measurable residual disease (MRD) negative remission (press release here). In February 2025, amid the promising early results and favorable safety from patients treated at the 40 mg dose level, the Cohort Safety Review Committee (CSRC) monitoring the TUSCANY trial approved escalating to 80 mg TUS in the triplet therapy (press release here). Subjects have now begun treatment at the 80 mg TUS dose level of the triplet therapy and further recruitment is under way. No significant safety concerns have been reported to date, including no prolonged myelosuppression of subjects in remission. This TUS+VEN+AZA triplet therapy study in newly diagnosed AML was supported with robust safety and efficacy data from the TUS single agent dose escalation study and the TUS+VEN doublet APTIVATE study in relapsed or refractory (R/R) AML, both of which were completed during 2024 after treating more than 170 patients.Financing Activity – During 2024, Aptose completed several financings for a total of approximately $37 million to support the TUS-based TUS+VEN+HMA triplet therapy development for AML. This included a $10 million loan Facility Agreement with Hanmi Pharmaceutical Co. Ltd. (“Hanmi”). Subsequently in March 2025, Hanmi and Aptose executed a Debt Conversion Agreement to convert a portion of the debt into equity, subject to Hanmi owning no more than 19.99% of the issued and outstanding common shares of Aptose. Therefore, an amount of $1.5 million has been converted into 409,063 common shares as of this date. Beyond the $10 million, Aptose and Hanmi are negotiating a new tuspetinib co-development collaboration agreement intended to provide additional funding to accelerate clinical development of tuspetinib. Aptose licensed tuspetinib from Hanmi Pharmaceutical in November 2021.Aptose Signs CRADA with NCI – In December, Aptose announced that it entered into a Cooperative Research and Development Agreement (“CRADA”) with the National Cancer Institute (NCI), part of the National Institutes of Health (press release here). Under the CRADA, the NCI and Aptose will collaborate on the clinical development of TUS, an inhibitor of key signaling kinases involved in myeloid malignancies, in the NCI Cancer Therapy Evaluation Program (CTEP) sponsored myeloMATCH trials employing combinations of targeted therapy for the treatment of molecularly defined AML and myelodysplastic syndromes (MDS) populations. These trials will be conducted by NCI's National Clinical Trials Network (NCTN), with the participation of the NCI Community Oncology Research Program (NCORP) in the U.S. and Canada.Aptose Meets Nasdaq Minimum Bid Compliance – Earlier this month, Aptose announced that it received a written notification from the Listing Qualifications Department of The Nasdaq Stock Market, LLC notifying the Company that it is in compliance with Nasdaq’s minimum bid price requirement (press release here). On March 14, 2025, Nasdaq confirmed that, for ten consecutive business days, the closing bid price of the Company’s common shares has been $1.00 per share or greater. Accordingly, the Company has regained compliance with Listing Rule 5550(a)(2). Separately, Aptose is not in compliance with the $2.5 million shareholders equity requirement and is operating under an exception granted by the Nasdaq Hearing Panel, which provides Aptose additional time to regain compliance, although there is no assurance that the Company will successfully achieve full compliance with the Nasdaq shareholders equity requirement. Completed and Planned Value-Creating Milestones 2024 Accomplishments Completed $10 million loan from Hanmi as Advance on CollaborationCompleted $8 million S-1 financingExecuted CRADA with NCI MyeloMATCH for tuspetinib in AML/MDSInitiated dosing of TUS+VEN+AZA triplet therapy in newly diagnosed AML patients in TUSCANY trialASH: Reported CR/Safety from APTIVATE TUS and TUS+VEN trialASH: Reported dosing accrual from TUS+VEN+AZA triplet therapy trial 2025: 1H Demonstrated safety and efficacy with 40mg TUS+VEN+AZA in triplet therapy trialDosing 80mg TUS in TUS+VEN+AZA dose cohort in triplet therapy trialExecuted Debt Conversion agreement with HanmiExpect to report CR/MRD/Safety data from TUS+VEN+AZA triplet therapy trialExpect to execute Hanmi/Aptose CollaborationEHA2025 Congress - Report maturing data readout from TUS+VEN+AZA triplet therapy trial 2025: 2H Select optimal TUS doses for TUS+VEN+HMA triplet therapy Ph 2/3 pivotal trialsPrepare for Ph 2 portion of Ph 2 / Ph 3 pivotal programAmerican Society of Hematology (ASH) Update FINANCIAL RESULTS OF OPERATIONSAptose Biosciences Inc.Statements of Operations Data(unaudited)($ in thousands, except for share and per share data) Year ended December 31, 20242023Expenses: Research and development$15,103 $36,765 General and administrative 11,154 15,591 Operating expenses 26,257 52,356 Other income, net 827 1,149 Net loss$(25,430)$(51,207) Net loss per share, basic and diluted$(36.38)$(227.43)Weighted average number of common shares outstanding used in computing net loss per share, basic and diluted 698,980 225,154 Net loss for the year ended December 31, 2024 decreased by $25.8 million to $25.4 million, as compared to $51.2 million for the comparable period in 2023. Aptose Biosciences Inc.Balance Sheet Data(unaudited)($ in thousands) December 31, December 31, 2024 2023Cash, cash equivalents and restricted cash equivalents$6,707 $9,252 Working capital 5,071 (3,375)Total assets 10,127 12,989 Long-term liabilities 10,211 621 Accumulated deficit (540,967) (515,537) Shareholders’ deficit (4,543) (2,901) Total cash, cash equivalents and restricted cash equivalents as of December 31, 2024, were $6.7 million. Based on current operations, the Company expects that cash on hand and available capital provides the Company with sufficient resources to fund planned Company operations including research and development until April 2025.As of March 21, 2025, we had 2,552,429 Common Shares issued and outstanding. In addition, there were 39,219 Common Shares issuable upon the exercise of outstanding stock options and there were 1,267,585 Common Shares issuable upon the exercise of the outstanding warrants. RESEARCH AND DEVELOPMENT EXPENSES The research and development expenses for the years ended December 31, 2024 and 2023 were as follows: Year ended December 31,(in thousands)20242023Program costs – Tuspetinib$9,606 $24,925Program costs – Luxeptinib 422 3,510Program costs – APTO-253 (19) 40Personnel related expenses 4,735 6,878Stock-based compensation 346 1,373Depreciation of equipment 13 39Total$15,103 $36,765 Research and development expenses decreased by $21.7 million to $15.1 million for year ended December 31, 2024, as compared to $36.8 million for the comparable period in 2023. Changes to the components of our research and development expenses presented in the table above are primarily as a result of the following events: Program costs for tuspetinib were $9.6 million for the year ended December 31, 2024, compared with $24.9 million for the comparable period in 2023. The lower program costs for tuspetinib in the current year were due to reduced activity in our APTIVATE clinical trial, reduced manufacturing costs, and related expenses. In the comparable period in 2023, Tuspetinib program costs included the healthy volunteer study, which was completed in the same year.Program costs for luxeptinib decreased by approximately $3.1 million primarily due to lower clinical trial and manufacturing activities.Program costs for APTO-253 decreased by approximately $59 thousand. This reduction was due to the Company’s decision to discontinue further development of APTO-253.Personnel-related expenses decreased by $2.1M due to lower headcount 2024.Stock-based compensation decreased by approximately $1.0 million in the year ended December 31, 2024, primarily due to stock options granted with lower grant date fair values when compared to the options granted in the prior period, coupled with option forfeitures recorded in the current year. About Aptose Aptose Biosciences is a clinical-stage biotechnology company committed to developing precision medicines addressing unmet medical needs in oncology, with an initial focus on hematology. The Company's small molecule cancer therapeutics pipeline includes products designed to provide single agent efficacy and to enhance the efficacy of other anti-cancer therapies and regimens without overlapping toxicities. The Company’s lead clinical-stage compound tuspetinib (TUS), is an oral kinase inhibitor that has demonstrated activity as a monotherapy and in combination therapy in patients with relapsed or refractory acute myeloid leukemia (AML) and is being developed as a frontline triplet therapy in newly diagnosed AML. For more information, please visit www.aptose.com. Forward Looking Statements This press release contains forward-looking statements within the meaning of Canadian and U.S. securities laws, including, but not limited to, statements regarding the Company’s clinical development plans, the clinical potential, anti-cancer activity, therapeutic potential and applications and safety profile of tuspetinib, clinical trials, the enrollment in clinical trials and the data therefrom, the submission of a compliance plan to Nasdaq and available options to regain compliance, upcoming milestones and presentation of additional data, financing activities, expectations regarding capital available to the Company to fund planned Company operations, maintenance of the Nasdaq and TSX listings, use of proceeds from financings, the conversion of debt into equity contemplated by the Debt Conversion Agreement entered into with Hanmi, the negotiation of a co-development collaboration agreement with Hanmi, the collaboration with the NCI for the clinical development of tuspetinib and statements relating to the Company’s plans, objectives, expectations and intentions and other statements including words such as “continue”, “expect”, “intend”, “will”, “hope” “should”, “would”, “may”, “potential” and other similar expressions. Such statements reflect our current views with respect to future events and are subject to risks and uncertainties and are necessarily based upon a number of estimates and assumptions that, while considered reasonable by us, are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors could cause our actual results, performance or achievements to be materially different from any future results, performance or achievements described in this press release. Such factors could include, among others: our ability to obtain the capital required for research and operations; the inherent risks in early stage drug development including demonstrating efficacy; development time/cost and the regulatory approval process; the progress of our clinical trials; our ability to find and enter into agreements with potential partners; our ability to attract and retain key personnel; changing market and economic conditions; unexpected manufacturing defects, the evolving regulatory and political landscape and the funding of government programs and other risks detailed from time-to-time in our ongoing current reports, quarterly filings, annual information forms, annual reports and annual filings with Canadian securities regulators and the United States Securities and Exchange Commission. Should one or more of these risks or uncertainties materialize, or should the assumptions set out in the section entitled "Risk Factors" in our filings with Canadian securities regulators and the United States Securities and Exchange Commission underlying those forward- looking statements prove incorrect, actual results may vary materially from those described herein. These forward-looking statements are made as of the date of this press release and we do not intend, and do not assume any obligation, to update these forward-looking statements, except as required by law. We cannot assure you that such statements will prove to be accurate as actual results and future events could differ materially from those anticipated in such statements. Investors are cautioned that forward-looking statements are not guarantees of future performance and accordingly investors are cautioned not to put undue reliance on forward-looking statements due to the inherent uncertainty therein. For further information, please contact: Aptose Biosciences Inc. Susan Pietropaolo Corporate Communications & Investor Relations 201-923-2049 spietropaolo@aptose.com

License out/inFinancial StatementClinical Result

28 Mar 2025

·www.prnewswire.com

Lomond Therapeutics Completes Second and Third Closings and adds Two New Investors

DOVER, Del., March 28, 2025 /PRNewswire/ -- Lomond Therapeutics Holdings, Inc. ("Lomond Therapeutics"), a clinical-stage biotechnology company dedicated to discovering and developing potentially best-in-class and first-in-class medicines for the treatment of hematological malignancies, today announced the addition of two new investors, Yosemite Capital and QIA Investments, coincident with a second and third closing, respectively, and the raising of an additional $20 million private placement financing. Continue Reading "We are delighted to expand the funding syndicate with the addition of these top tier investors," said Iain Dukes M.A. D.Phil., co-founder and chief executive officer at Lomond Therapeutics." Lomond Therapeutics announced the addition of two new investors, and the raising of an additional $20 million. Post this This transaction provides the additional resources necessary to advance our potentially best-in-class or first-in-class programs, lomonitinib, lonitoclax and our menin inhibitor, through clinical development. Lomonitinib is currently being evaluated in a Phase 1b clinical trial in patients with mutated FLT3 relapsed refractory AML - an area of important unmet need. Lomond enrolls CLL and selected lymphoma patients in a Phase 1b clinical trial to evaluate lonitoclax, a potentially first in class oral targeted selective B-cell lymphoma-2 ("BCL-2-2") inhibitor. The offering was exempt from registration under Section 4(a)(2) of the United States Securities Act of 1933, as amended, and Rule 506 of Regulation D promulgated by the U.S. Securities and Exchange Commission ("SEC") thereunder. The Common Stock in the offering was sold to "accredited investors," as defined in Regulation D, and was conducted on a "reasonable best efforts" basis. This press release shall not constitute an offer to sell or the solicitation of an offer to buy these securities, nor shall there be any sale of these securities in any jurisdiction in which such offer, solicitation or sale would be unlawful prior to the registration or qualification under the securities laws of any such jurisdiction. Raymond James and Wedbush & Co. acted as the placement agents. About Lomond Therapeutics Lomond Therapeutics is a biopharmaceutical company co-founded by OrbiMed, Torrey Pines Investment and Dr. John C. Byrd, focused on the discovery and development of best-in-class and first-in-class small molecule inhibitors that target escape mutations in hematologic cancers. The company is utilizing a proprietary hybrid AI platform of Expert Systems Inc., leveraging its key partners' proprietary data, chem-bio platforms, knowledge and expertise to choose highly valuable molecular mechanisms of pathology; to precisely design and accelerate the execution of discovery and development of best-in-class and first-in-class therapies. Lomond Therapeutics' goal is to utilize its capabilities and platform to become a leader in developing novel breakthrough medicines to maximize the clinical benefit when treating hematologic malignancies. For more information visit . About Lomonitinib Lomonitinib is a novel, small molecule inhibitor that has been designed to block activity of all major known resistance mutations of FMS-like tyrosine kinase 3, ("FLT3"), FLT3 Internal Tandem Duplication ("ITD"), FLT3 Tyrosine Kinase Domain ("TKD") and other clinically relevant FLT3 mutations that drive acute myeloid leukemia ("AML"), as well as interleukin-1 receptor-associated kinase 4. FLT3 mutations are the most frequently identified mutations inAML. Existing FLT3 inhibitors are limited by the emergence of resistance mutations or escape pathways, lack of selectivity and safety profile, as clinical data have demonstrated their inability to inhibit disease progression. Lomonitinib has demonstrated anti-tumor activity in cellular assays and in animal models against both activating and resistance mutations. Lomonotinib is currently being evaluated in a Phase 1b clinical trial in Australia and the United States to assess the safety, tolerability, pharmacodynamic responses and efficacy of lomonitinib as a single agent in patients with relapsed and refractory AML patients who have tested positive for a dominant FLT3 mutation. About Lonitoclax Lonitoclax is an inhibitor of the anti-apoptotic protein BCL-2, a key pro-survival protein that is overexpressed in many cancers, for the treatment of patients with AML and CLL. We believe lonitoclax could be a first in class oral binder with superior potency and selectivity against BCL-2. This clinical candidate demonstrated equivalent in vivo anti-tumor efficacy to venetoclax, the only approved inhibitor of BCL2 for the indications of AML and CLL, in B cell and myeloid malignancy cell lines and in vivo models. Compared to venetoclax, lonitoclax exhibits significantly less suppression of non-malignant immune cell populations, a result that suggests superior selectivity and an improved safety profile. We completed a series of healthy volunteer studies evaluating lonitoclax where no drug-related adverse effects were observed at exposures where ex vivo activation of caspase in CLL primary cells was observed, a surrogate marker of BCL-2 inhibition in tumors. This emphasizes important advantages over venetoclax and venetoclax-like molecules in safety, tolerability and feasibility of outpatient treatment, enabling the molecule to safely target AML and CLL patients alone and in combination with other targeted therapies. Lomond currently enrolls CLL and selected lymphoma patients under an approved US IND. About our early stage menin-inhibitor We have obtained an exclusive license from Bala Therapeutics, Inc. ("Bala") to a class of menin inhibitors for the treatment of NPM-1 and MLL-rearranged AML. Menin is a central player in cells that brings other proteins together to regulate the expression of genes thar are key to cell growth. In the second half of 2025, we expect to select one of the menin inhibitors as a candidate for further preclinical study and, if the results are supportive, potentially clinical study. Forward Looking Statements This press release contains forward-looking statements. Statements in this press release that are not purely historical are forward-looking statements. Such forward-looking statements include, among other things, references to our product candidates and the development and therapeutic potential thereof, statements regarding the timing, progress and results of our clinical studies and trials for our current product candidates, including statements regarding the timing of completion or initiation of trials, and the reporting of data from our current trials, our plans relating to the clinical development of our product candidates, the beneficial characteristics of our product candidates, the timing of regulatory filings and approvals for our product candidates, our ability to obtain and maintain regulatory approval for our product candidates, the expected potential benefits of strategic collaborations with related and third parties, our technologies for identifying additional product candidates, the intended use of proceeds from the private placement transaction, and our business and development plans. Actual results could differ from those projected in any forward-looking statements due to numerous factors. Such factors include, among others, our ability to raise the additional funding we will need to continue to pursue our business and product development plans, the inherent uncertainties associated with developing product candidates and operating as a development stage company, our ability to identify additional product candidates for development, our ability to develop, complete clinical trials for, obtain approvals for and commercialize any of our product candidates, and competition in the industry in which we operate and market conditions. These forward-looking statements are made as of the date of this press release, and the company assumes no obligation to update the forward-looking statements, or to update the reasons why actual results could differ from those projected in the forward-looking statements, except as required by law. Investors should consult all of the information set forth herein and should also refer to the risk factor disclosure set forth in the reports and other documents we file with the SEC available at . Media Contact: Amy Burd CSO [email protected] SOURCE Lomond Therapeutics WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

Phase 1License out/inDrug Approval

100 Deals associated with Venetoclax

External Link

KEGG	Wiki	ATC	Drug Bank
D10679	Venetoclax	L01XX52	DB11581

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Mantle cell lymphoma recurrent	Japan	AbbVie LLC	27 Mar 2025
Mantle cell lymphoma refractory	Japan	AbbVie LLC	27 Mar 2025
Chronic lymphocytic leukaemia refractory	Japan	AbbVie LLC	20 Sep 2019
Recurrent Chronic Lymphoid Leukemia	Japan	AbbVie LLC	20 Sep 2019
Small Lymphocytic Lymphoma	United States	AbbVie, Inc.	08 Jun 2018
Adult Acute Myeloblastic Leukemia	European Union	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Iceland	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Liechtenstein	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Norway	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Acute Myeloid Leukemia	Canada	AbbVie AS	31 Oct 2016
Chronic Lymphocytic Leukemia	United States	AbbVie, Inc.	11 Apr 2016

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Tumor Lysis Syndrome	Phase 3	United States	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Australia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	France	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Greece	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Puerto Rico	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Serbia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Spain	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Taiwan Province	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	United Kingdom	AbbVie, Inc.	05 Aug 2024
Relapsing acute myeloid leukemia	Phase 3	United States	AbbVie, Inc.	01 Oct 2022

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


NCT04599634 (CTgov)	Phase 1	Follicular Lymphoma \| Mantle-Cell Lymphoma \| Chronic Lymphocytic Leukemia ... View more	11	venetoclax+magrolimab+obinutuzumab (Arm 1, Cohort 1 Follicular Lymphoma Level 1)	sajmbkmmht = bfxretrawq trgjzmnhyl (hzzhsldeea, rzozvrrvxx - fmffoknqsk) View more	-	25 Mar 2025
NCT04599634 (CTgov)	Phase 1		11	venetoclax+magrolimab+obinutuzumab (Arm 2, Cohort 2 Marginal Zone Lymphoma, Mantle Cell Lymphoma, & Chronic Lymphocytic Leukemia Level 1)	sajmbkmmht = gmsnhhelif trgjzmnhyl (hzzhsldeea, dyrwiaptkd - cehmiekstr) View more	-	25 Mar 2025
NCT04477486 (CTgov)	Phase 2	Mantle cell lymphoma refractory	13	Ibrutinib+Venetoclax	ftrckodkck = szdycsvtls mcxvxvrjws (vtisomnblc, gpfkybmipq - mvjwbdsnus)	-	25 Mar 2025
NCT02942290 (Pubmed \| Blood)	Phase 1	High Risk Myelodysplastic Syndrome	107	Venetoclax 400 mg	znbustwyfk(ldcswqyzog) = eytzfgicpi gixjkfuizy (dpyrkixxbt ) View more	Positive	13 Mar 2025
NCT03236857 (Pubmed \| Pediatr Blood Cancer)	Phase 1	Recurrent Childhood Acute Lymphoblastic Leukemia	-	Venetoclax monotherapy	fxxhnskiad(zzbkkakkgu) = One fatal adverse event possibly related to venetoclax occurred zkzvhkdkid (ugycveimdv ) View more	Positive	10 Mar 2025
NCT03214562 (Pubmed \| Leukemia)	Phase 1/2	Refractory acute myeloid leukemia wild-type TP53 status	138	FLAG-IDA + Venetoclax	lmxuauwtff(bxarqbahjk) = low eskxzbcrqw (poqogepytf ) View more	Positive	25 Feb 2025
NCT03836261 (NEWS \| Pubmed) Manual	Phase 3	Chronic Lymphocytic Leukemia First line	867	Acalabrutinib-Venetoclax	xkujezywgs(txohdhvnpl) = jxlxkfhsof htesgvwbyz (aotpmvxyfv ) View more	Positive	21 Feb 2025
NCT03836261 (NEWS \| Pubmed) Manual	Phase 3	Chronic Lymphocytic Leukemia First line	867	Acalabrutinib-Venetoclax-Obinutuzumab	xkujezywgs(txohdhvnpl) = wxhcjpashx htesgvwbyz (aotpmvxyfv ) View more	Positive	21 Feb 2025
NCT03319901 (Pubmed \| Blood Adv)	Phase 1	Acute Lymphoblastic Leukemia hypodiploid TP53-mutated	19	Venetoclax + Mini-HCVD	ntaimlkoni(srvjdepinj) = swkdnbjqjl xaymsidywd (zigirwhpmp, 71 - 100) View more	Positive	11 Feb 2025
NCT03709758 (ASH2024) Manual	Phase 1	Acute Myeloid Leukemia First line	44	Venetoclax + Daunorubicin + Cytarabine	dracqkzfds(tmfexxfcbc) = 100 mg/d venetoclax was the MTD for pts treated with consol ara-C at 3 gm/m2. vsczsgdihr (mwjnzdhrkm ) View more	Positive	09 Dec 2024
ASH2024 Manual	Not Applicable	Chronic Lymphocytic Leukemia First line	-	Venetoclax + obinutuzumab (VO)	brjqajwgmn(jkznlcrnon) = cjzaxinbrc mmpqpebzba (qiawjwvadv ) View more	Positive	09 Dec 2024
ASH2024 Manual	Not Applicable	Chronic Lymphocytic Leukemia First line	-	Bruton tyrosine kinase inhibitor (BTKi)	brjqajwgmn(jkznlcrnon) = zjorblwzyz mmpqpebzba (qiawjwvadv ) View more	Positive	09 Dec 2024
ASH2024 Manual	Phase 1	Non-Hodgkin Lymphoma	13	Loncastuximab tesirine + Venetoclax	bjcgfqyuao(zctnzbpnhp) = jjinwngply arexqwtefy (qpounermbj ) View more	Positive	09 Dec 2024

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

Chat with Hiro

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis