Request Demo

Last update 23 Jun 2025

Venetoclax

Last update 23 Jun 2025

Overview

R&D Status

Clinical Result

Translational Medicine

Overview

Basic Info

Drug Type

Small molecule drug

Synonyms

VENCLYXTO, Venetoclax (JAN/USAN/INN), 维奈妥拉

+ [15]

Target

Bcl-2

Action

inhibitors

Mechanism

Bcl-2 inhibitors(Apoptosis regulator Bcl-2 inhibitors)

Therapeutic Areas

NeoplasmsImmune System DiseasesHemic and Lymphatic Diseases+ [7]

Active Indication

Mantle cell lymphoma recurrentMantle cell lymphoma refractoryChronic lymphocytic leukaemia refractory+ [130]

Inactive Indication

Aggressive Non-Hodgkin LymphomaB-cell lymphoma recurrentB-cell lymphoma refractory+ [23]

Originator Organization

Genentech, Inc.

AbbVie, Inc.

Active Organization

AbbVie, Inc.

Pharmacyclics LLCServier Bio-Innovation LLC

+ [30]

Inactive Organization

Janssen Research & Development LLCJanssen Scientific Affairs LLC

Janssen Pharmaceuticals, Inc.

License Organization

The University of Texas MD Anderson Cancer Center

Astex Pharmaceuticals, Inc.

Tolero Pharmaceuticals, Inc.

+ [4]

Drug Highest PhaseApproved

First Approval Date

United States (11 Apr 2016),

Chronic Lymphocytic Leukemia

RegulationBreakthrough Therapy (United States), Accelerated Approval (United States), Orphan Drug (United States), Orphan Drug (European Union), Conditional marketing approval (China), Orphan Drug (Australia), Special Review Project (China)

Structure/Sequence

Molecular FormulaC45H50ClN7O7S

InChIKeyLQBVNQSMGBZMKD-UHFFFAOYSA-N

CAS Registry1257044-40-8

726

Clinical Trials associated with Venetoclax

NCT06770257

/ WithdrawnPhase 2IIT

A Randomized Phase ll Study Evaluating the Efficacy and Safety of Combination Therapy of Daunorubicin, Cytarabine Liposomes and Venetoclax Versus Combination Therapy of Azacitidine and Venetoclax in Newly Diagnosed AML Patients Not Eligible for Intensive Chemotherapy

Daunorubicin, Cytarabine Liposomes(CSPC Zhongnuo Pharmaceutical (Shijiazhuang) Co., Ltd.) is a dual-drug liposomal encapsulation of cytarabine and daunorubicin at a fixed 5:1 synergistic molar ratio.
This is a phase 2, randomized, controlled study in patients who are >= 18 or more years old and have not been treated before. Participants who take part in this study should not be suitable for intensive induction therapy.
In this study, patients will be randomized by 1:1:1 to receive Daunorubicin, Cytarabine Liposomes + Venetoclax(14d) or Daunorubicin, Cytarabine Liposomes + Venetoclax(21d) or Venetoclax + Azacitidine.
Participants will continue to have study visits and receive treatment for as long as they are having a clinical benefit.

Start Date10 Dec 2025

Sponsor / Collaborator

CSPC ZhongNuo Pharmaceutical (Shijiazhuang) Co. Ltd.

NCT06917911

/ Not yet recruitingPhase 2IIT

Phase II Study of Cytarabine + Daunorubicin (7 + 3) + Gemtuzumab Ozogamicin vs. Cytarabine + Daunorubicin (7 + 3) + Venetoclax for the Treatment of Newly Diagnosed Core Binding Factor Acute Myeloid Leukemia (CBF-AML) in Younger Adults: A MyeloMATCH Substudy

This phase II MyeloMATCH treatment trial compares the effect of venetoclax to gemtuzumab ozogamicin, when given with cytarabine and daunorubicin ("7+3" regimen), for the treatment of patients with core binding factor acute myeloid leukemia (CBF-AML). Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking Bcl-2, a protein needed for cancer cell survival. Gemtuzumab ozogamicin is a monoclonal antibody, called gemtuzumab, linked to an antitumor antibiotic drug, called ozogamicin. Gemtuzumab is a form of targeted therapy because it attaches to specific molecules (receptors) on the surface of cancer cells, known as CD33 receptors, and delivers ozogamicin to kill them. Chemotherapy drugs, such as cytarabine and daunorubicin work in different ways to stop the growth of cancer cells either by killing the cells, by stopping them from dividing, or by stopping them from spreading. Giving venetoclax with cytarabine and daunorubicin may have fewer side effects and be as effective or better than the combination with gemtuzumab ozogamicin in treating patients with core binding factor AML.

Start Date20 Nov 2025

Sponsor / Collaborator

National Cancer Institute

NCT06967610

/ Not yet recruitingPhase 2IIT

Phase II Study of Combined Pirtobrutinib, Venetoclax and Obinutuzumab (PVO) Time-limited Treatment for Patients With Recurrent Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma (CLL/SLL).

To learn if the drug combination pirtobrutinib, venetoclax, and obinutuzumab can help to control relapsed CLL/SLL.

Start Date30 Oct 2025

Sponsor / Collaborator

The University of Texas MD Anderson Cancer Center

[+1]

100 Clinical Results associated with Venetoclax

100 Translational Medicine associated with Venetoclax

100 Patents (Medical) associated with Venetoclax

5,289

Literatures (Medical) associated with Venetoclax

31 Dec 2025·ANNALS OF MEDICINE

Significant prognostic improvement in elderly patients with acute myeloid leukemia treated with hypomethylating agents and venetoclax: outcomes from a retrospective real-world analysis

Article

Author: Zheng, Jing ; Wu, Yong ; Wu, Lanlan ; Chen, Yi ; Zhou, Jiayi ; Wu, Zhengjun ; Cai, Ruyu ; Wang, Zhengyang

OBJECTIVE:

This investigation aim to analyze the clinical features and therapeutic outcomes of elderly patients with acute myeloid leukemia (AML).

METHOD:

We conducted a retrospective analysis of the clinical and cytogenetic profiles of patients aged 60 years and older diagnosed with AML at the Fujian Medical University Union Hospital from 2016 to 2024.

RESULTS:

Our study cohort included 846 patients, with a median age of 67 years. The median duration of response (DOR) was 15.8 months, with 1-year, 3-year, and 5-year DOR rates of 55.3%, 23.4%, and 13.1%, respectively. The median overall survival (OS) was 21.8 months, with corresponding 1-year, 3-year, and 5-year OS rates of 58.7%, 41.2%, and 30.0%. Patients who received the azacitidine and venetoclax treatment protocol exhibited a complete remission (CR) rate of 57.1% and a minimal residual disease (MRD) - negative rate of 34.1%. These rates were comparable to the 59.2% CR rate and 39.4% MRD-negative rate observed in patients treated with intensive chemotherapy, and were superior to those with other low-intensity regimens. Compared to the treatment outcomes achieved at our center prior to 2016, when chemotherapy was the predominant treatment modality, which were characterized by a CR rate of 42.7%, a median OS of 9.2 months, and a mere 5-year OS rate of 13.5%, the remission rate and long-term survival of elderly patients with AML have been remarkable improved.

CONCLUSION:

The integration of hypomethylating agents and venetoclax into the treatment paradigm for elderly patients with AML has significantly enhanced survival rates.

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

31 Dec 2025·CANCER BIOLOGY & THERAPY

Targeting the IKZF1/BCL-2 axis as a novel therapeutic strategy for treating acute T-cell lymphoblastic leukemia

Article

Author: Li, Jun ; Ye, Chunmei ; Li, Hui ; Li, Juan

OBJECTIVES:

Acute T-cell lymphoblastic leukemia (T-ALL) is a severe hematologic malignancy with limited treatment options and poor long-term survival. This study explores the role of IKZF1 in regulating BCL-2 expression in T-ALL.

METHODS:

CUT&Tag and CUT&Run assays were employed to assess IKZF1 binding to the BCL-2 promoter. IKZF1 overexpression and knockdown experiments were performed in T-ALL cell lines. The effects of CX-4945 and venetoclax, alone and in combination, were evaluated in vitro and in vivo T-ALL models.

RESULTS:

CUT&Tag sequencing identified IKZF1 binding to the BCL-2 promoter, establishing it as a transcriptional repressor. Functional assays demonstrated that IKZF1 overexpression reduced BCL-2 mRNA levels and increased repressive histone marks at the BCL-2 promoter, while IKZF1 knockdown led to elevated BCL-2 expression. CX-4945, a CK2 inhibitor, could reduced BCL-2 levels in T-ALL cells. Notably, knockdown of IKZF1 partially rescued the CX-4945-induced repression of BCL-2. These results underscore the CK2-IKZF1 signaling axis as a key regulator of BCL-2 expression. In vitro, CX-4945 enhanced the cytotoxicity of venetoclax, with the combination showing significant synergistic effects and increased apoptosis in T-ALL cell lines. In vivo studies with cell line-derived xenograft (CDX) and patient-derived xenograft (PDX) models demonstrated that CX-4945 and venetoclax combined therapy provided superior therapeutic efficacy, reducing tumor burden and prolonging survival compared to single-agent treatments.

CONCLUSIONS:

IKZF1 represses BCL-2 in T-ALL, and targeting the CK2-IKZF1 axis with CX-4945 and venetoclax offers a promising therapeutic strategy, showing enhanced efficacy and potential as a novel treatment approach for T-ALL.

1,072

News (Medical) associated with Venetoclax

23 Jun 2025

·pipelinereview.com

Early data suggest Roche’s NXT007 may have the potential to provide haemostatic normalisation in people with haemophilia A

BASEL, Switzerland I June 23, 2025 I Roche (SIX: RO, ROG; OTCQX: RHHBY) announced today positive phase I/II data on NXT007 in people with haemophilia A, supporting its progression into phase III clinical development. NXT007 is a next-generation investigational bispecific antibody, engineered by Chugai, a member of the Roche Group. Early data from the NXTAGE study suggest that NXT007 may have the potential to provide haemostatic normalisation in people with haemophilia A (without factor VIII inhibitors). NXT007 showed a tolerable safety profile with no thromboembolic events reported so far. 1 These results were featured as an oral presentation at the 2025 International Society on Thrombosis and Haemostasis (ISTH) Congress, 21-25 June, Washington D.C., United States. 1 “These NXT007 data are promising for people with haemophilia A and underscore our ongoing commitment to advancing care and addressing the real-world challenges faced by this community,” said Levi Garraway, MD, PhD, Roche’s Chief Medical Officer and Head of Global Product Development. “Hemlibra established a new standard of care, and our focus is to continue to deliver breakthrough innovation that might ultimately help people with haemophilia to live their lives in a manner unaffected by this condition.” NXT007 leverages the Roche Group’s expertise in haemophilia A and bispecific antibody development. Our goal is to bring a next generation prophylactic to our portfolio, offering greater therapeutic choice, sustained, elevated bleed protection and reduced treatment burden with factor independence – to allow patients to experience freedom from constant vigilance and have confidence in bleed protection. NXT007 will be further evaluated in a robust clinical development programme, including ongoing phase I/II clinical trials, with additional phase II data expected later this year. There are also three phase III studies currently planned for 2026, including a phase III head-to-head study with Roche’s Hemlibra, the first available prophylactic treatment that can be administered subcutaneously and with flexible dosing options (every week, two weeks or four weeks). 4,5 Part B of the phase I/II NXTAGE study, conducted by Chugai, in Japan, Taiwan and South Korea, is evaluating the safety, pharmacokinetics, pharmacodynamics and efficacy of prophylaxis with NXT007 in people with haemophilia A without factor VIII inhibitors who had not been previously treated with Hemlibra® (emicizumab). 1 Thirty participants (from 12 to 65 years of age) were enrolled in four cohorts (B-1 to B-4) to receive ascending doses of subcutaneous NXT007 every two-to-four weeks during the maintenance period (following four-to-six weeks of loading doses). In presented data from the primary analysis, no treated bleeds were observed with NXT007 in the highest dose cohorts (B-3 and B-4). NXT007 was well tolerated, with no thromboembolic events observed so far. 1 About NXT007 NXT007 is a next-generation investigational bispecific antibody, being investigated as a prophylactic (preventive) treatment option for people with haemophilia A. 1,2,3 NXT007 was engineered by Chugai – a member of the Roche Group – built on Hemlibra® (emicizumab)’s framework, with the aim of optimising factor VIII-mimetic activity and half-life, to further enhance potency, efficacy, dosing and administration convenience. NXT007 brings together factor IXa and factor X, proteins required to activate the natural coagulation cascade. 1,2,3 NXT007 is being studied in a robust clinical development programme exploring its potential to achieve sustained elevated bleed protection equivalent to people who do not have haemophilia A (sustained haemostatic normalisation), and reduced treatment burden with factor independence, offering people living with haemophilia A greater therapeutic choice. 1,2,3 About haemophilia A Haemophilia A is an inherited, serious disorder in which a person’s blood does not clot properly, leading to uncontrolled and often spontaneous bleeding. Haemophilia A affects around 900,000 people worldwide. 6,7 People with haemophilia A either lack or do not have enough of a clotting protein called factor VIII. In a healthy person, when a bleed occurs, factor VIII brings together the clotting factors IXa- and X, which is a critical step in the formation of a blood clot to help stop bleeding. Depending on the severity of their symptoms, people with haemophilia A can bleed frequently, especially into their joints or muscles. 8 These bleeds can present a significant health concern as they often cause pain and can lead to chronic swelling, deformity, reduced mobility and long-term joint damage. 9 A serious complication of treatment is the development of inhibitors to factor VIII replacement therapies. Inhibitors are antibodies developed by the body’s immune system that bind to and block the efficacy of replacement factor VIII, making it difficult, if not impossible, to obtain a level of factor VIII sufficient to control bleeding. 6 About Roche in haematology Roche has been developing medicines for people with malignant and non-malignant blood diseases for more than 25 years; our experience and knowledge in this therapeutic area runs deep. Today, we are investing more than ever in our effort to bring innovative treatment options to patients across a wide range of haematologic diseases. Our approved medicines include MabThera®/Rituxan® (rituximab), Gazyva®/Gazyvaro® (obinutuzumab), Polivy® (polatuzumab vedotin), Venclexta®/Venclyxto® (venetoclax) in collaboration with AbbVie, Hemlibra® (emicizumab), PiaSky® (crovalimab), Lunsumio® (mosunetuzumab) and Columvi® (glofitamab). Our pipeline of investigational haematology medicines includes T-cell engaging bispecific antibody cevostamab, targeting both FcRH5 and CD3 and Tecentriq® (atezolizumab). Our scientific expertise, combined with the breadth of our portfolio and pipeline, also provides a unique opportunity to develop combination regimens that aim to improve the lives of patients even further. About Roche Founded in 1896 in Basel, Switzerland, as one of the first industrial manufacturers of branded medicines, Roche has grown into the world’s largest biotechnology company and the global leader in in-vitro diagnostics. The company pursues scientific excellence to discover and develop medicines and diagnostics for improving and saving the lives of people around the world. We are a pioneer in personalised healthcare and want to further transform how healthcare is delivered to have an even greater impact. To provide the best care for each person we partner with many stakeholders and combine our strengths in Diagnostics and Pharma with data insights from the clinical practice. For over 125 years, sustainability has been an integral part of Roche’s business. As a science-driven company, our greatest contribution to society is developing innovative medicines and diagnostics that help people live healthier lives. Roche is committed to the Science Based Targets initiative and the Sustainable Markets Initiative to achieve net zero by 2045. Genentech, in the United States, is a wholly owned member of the Roche Group. Roche is the majority shareholder in Chugai Pharmaceutical, Japan. For more information, please visit www.roche.com . All trademarks used or mentioned in this release are protected by law. References [1] 1. Shima M, et al. NXT007 Prophylaxis in Emicizumab-Naive Persons with Hemophilia A without Inhibitor: Phase I/II Study (NXTAGE) Presented at International Society on Thrombosis and Haemostasis (ISTH) congress; 2025 June. Abstract OC.20.3. [2] Shima M, et al. Safety, Pharmacokinetics, and Pharmacodynamics of Single Subcutaneous Injection of NXT007, an Emicizumab-Based Next-Generation Bispecific Antibody, in Healthy Volunteers (NXTAGE Study). Presented at: International Society on Thrombosis and Haemostasis (ISTH) Congress; 2023 July 28. Abstract OC 69.4. [3] Teranishi-Ikawa Y., et al. A bispecific antibody NXT007 exerts a hemostatic activity in hemophilia A monkeys enough to keep a non-hemophiliac state. Journal of Thrombosis and Haemostasis. 2023; doi: 10.1016/j.jtha.2023.09.034 [4] Hemlibra SmPC [Internet; cited 2025 June] Available from: https://www.medicines.org.uk/emc/product/9043/smpc [5] FDA Prescribing Information [Internet; cited 2025 June]. Available from: https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/761083s002s004lbl.pdf . [6] Srivastava A, et al. WFH guidelines for the management of hemophilia, 3rd edition. Haemophilia. 2020;26 (Suppl 6): 1-158. [7] Iorio A, et al. Establishing the Prevalence and Prevalence at Birth of Hemophilia in Males. Ann Intern Med. 2019;171(8):540-546. [8] NHS. Symptoms of haemophilia [Internet; cited 2025 June]. Available from: https://www.nhs.uk/conditions/haemophilia/symptoms/ . [9] Franchini M, et al. Haemophilia A in the third millennium. Blood Rev. 2013; 179-84. SOURCE: Roche

Clinical ResultPhase 3

20 Jun 2025

·www.prnewswire.com

LOMOND THERAPEUTICS ANNOUNCES U.S. FDA CLEARANCE OF IND APPLICATION FOR LONITOCLAX, A SELECTIVE BCL2 INHIBITOR WITH LIMITED IMMUNE SUPPRESSION AND IMPROVED SAFETY COMPARED TO VENETOCLAX AND VENETOCLAX- LIKE MOLECULES

DOVER, Del., June 20, 2025 /PRNewswire/ -- Lomond Therapeutics Holdings, Inc. ("Lomond Therapeutics"), a clinical-stage biotechnology company dedicated to discovering and developing potentially best-in-class and first-in-class medicines for the treatment of hematological malignancies, today announced that the U.S. Food and Drug Administration (FDA) has cleared it's Investigational New Drug (IND) application for a Phase 1 multicenter study evaluating the feasibility, safety, and efficacy of lonitoclax in patients with relapsed/refractory acute myeloid leukemia (AML). Continue Reading "The acceptance of our third U.S. IND is an important milestone for Lomond Therapeutics", said Iain Dukes, Chief Executive Officer of Lomond Therapeutics. "This IND clearance allows us to begin the next stages of our clinical development for lonitoclax focusing on acute myeloid leukemia (AML). Through this Phase 1 study, we aim to advance our understanding of safety, tolerability, manufacturing feasibility and mechanism of action of lonitoclax." Lomond Therapeutics today announced that the U.S. FDA has cleared it's IND application for a Phase 1 multicenter study Post this About Lomond Therapeutics Lomond Therapeutics is a biopharmaceutical company co-founded by Orbimed, Torrey Pines Investment and Dr. John C. Byrd, focused on the discovery and development of best-in-class and first-in-class small molecule inhibitors that target escape mutations in hematologic and solid cancers. The company is utilizing a proprietary hybrid AI platform of Expert Systems Inc., leveraging its key partners proprietary data, chem/bio tools, knowledge and expertise to choose highly valuable molecular mechanism of pathology, to rationally design, accelerate discovery and optimize development of best-in-class and first-in-class therapies. Lomond Therapeutics' goal is to utilize its capabilities and platform to become a leader in developing novel breakthrough medicines to maximize the clinical benefit when treating hematologic and solid malignancies. For more information visit . About Lonitoclax Lonitoclax has earlier reported novel binding, best-in-class potency and selectivity against BCL2, a key pro-survival protein that is overexpressed in many cancers. To mitigate the hematologic and immune toxicities observed with venetoclax, lonitoclax was designed with a unique binding to improve selectivity for Bcl-2 over Bcl-xL. In addition, a shorter half-life and reduced P4503A4 inhibition properties were built into the molecule to mitigate tumor lysis syndrome and drug accumulation risk, respectively. Lonitoclax has demonstrated monotherapy activity in pre-clinical models, as well as synergistic activity when combined with azacytidine, FLT3 inhibitors, and menin inhibitors in AML xenograft models. Unlike venetoclax, lonitoclax had minimal immunosuppressive activity on B cells, CD8 T cells, and NK cells in preclinical models. Lonitoclax has completed a series of healthy volunteer studies where no significant safety signals were observed at exposures where ex vivo activation of caspase in CLL primary cells was observed, a surrogate marker of BCL-2 inhibition in tumors. This emphasizes important advantages over venetoclax and venetoclax-like molecules in safety, tolerability and feasibility of outpatient treatment, enabling the molecule to safely target AML and CLL patients alone and in combination with other targeted therapies. About the Phase 1 Clinical Trial The Phase 1 study will evaluate the safety, tolerability, pharmacokinetics, and anti-tumor activity of lonitoclax in combination with azacitidine in R/R AML. The study will include a dose escalation and an expansion phase with up to 60 total participants. Lomond Therapeutics is planning to initiate the study in the third quarter of 2025 across multiple investigative sites. Forward Looking Statements This press release contains forward-looking statements. Statements in this press release that are not purely historical are forward-looking statements. Such forward-looking statements include, among other things, references to our product candidates and the development and therapeutic potential thereof, statements regarding the timing, progress and results of our clinical studies and trials for our current product candidates, including statements regarding the timing of completion or initiation of trials, and the reporting of data from our current trials, our plans relating to the clinical development of our product candidates, the beneficial characteristics of our product candidates, the timing of regulatory filings and approvals for our product candidates, our ability to obtain and maintain regulatory approval for our product candidates, the expected potential benefits of strategic collaborations with related and third parties, our technologies for identifying additional product candidates and our business and development plans. Actual results could differ from those projected in any forward-looking statements due to numerous factors. Such factors include, among others, our ability to raise the additional funding we will need to continue to pursue our business and product development plans, the inherent uncertainties associated with developing product candidates and operating as a development stage company, our ability to identify additional product candidates for development, our ability to develop, complete clinical trials for, obtain approvals for and commercialize any of our product candidates, and competition in the industry in which we operate and market conditions. Investors should consult all of the information set forth herein and should also refer to additional risks set forth under the heading "Risk Factors" in Lomond Therapeutics' filings with the U.S. Securities and Exchange Commission (SEC) available at . These forward-looking statements are made as of the date of this press release, and Lomond Therapeutics assumes no obligation to update the forward-looking statements, or to update the reasons why actual results could differ from those projected in the forward-looking statements, except as required by law. Media Contact: Amy Burd CSO [email protected] SOURCE Lomond Therapeutics WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

Phase 1IND

20 Jun 2025

·www.globenewswire.com

Aptose and Hanmi Enter New Loan Agreement to Advance Development of Tuspetinib in Triplet Therapy for AML

SAN DIEGO and TORONTO, June 20, 2025 (GLOBE NEWSWIRE) -- Aptose Biosciences Inc. ("Aptose" or the "Company") (TSX: APS; OTC: APTOF), a clinical-stage precision oncology company developing a tuspetinib (TUS) based triple drug frontline therapy to treat patients with newly diagnosed acute myeloid leukemia (AML), today announced that it has entered into a new loan agreement (the “Loan Agreement”) with Hanmi Pharmaceutical Co. Ltd. (“Hanmi”). The Loan Agreement is an uncommitted facility for up to US$8.5million, administered through multiple advances for the purpose of continued clinical development of TUS. The Loan Agreement constitutes a “related-party transaction” within the meaning of Multilateral Instrument 61-101 – Protection of Minority Security Holders in Special Transactions (“MI 61-101”) as Hanmi is a related party of the Company under Canadian securities laws. However, the Company is relying on the exemption from the formal valuation and minority shareholder approval requirements contained in MI 61-101 on the basis of the “financial hardship” exemption therein. “Aptose is incredibly grateful for Hanmi’s continued support tuspetinib,” said William G. Rice, Ph.D., Chairman, President and Chief Executive Officer of Aptose. “Our data to date in the TUS+VEN+AZA triplet reveal promising antileukemic activity and safety across diverse AML populations – some with the greatest unmet needs.” Tuspetinib is a convenient once daily oral agent that potently targets SYK, mutated and wild type forms of FLT3, mutated KIT, JAK1/2, and RSK2 kinases, while avoiding many typical toxicity concerns observed with other agents. The ongoing TUSCANY triplet Phase 1/2 study is designed to test various doses and schedules of TUS in combination with standard dosing of azacitidine and venetoclax in newly diagnosed patients with AML who are ineligible to receive induction chemotherapy. Aptose recently reported early data from the first two dose cohorts that have demonstrated safety, CRs and minimal residual disease (MRD) negativity across patients with diverse mutations (press release here). About Aptose Aptose Biosciences is a clinical-stage biotechnology company committed to developing precision medicines addressing unmet medical needs in oncology, with an initial focus on hematology. The Company's small molecule cancer therapeutics pipeline includes products designed to provide single agent efficacy and to enhance the efficacy of other anti-cancer therapies and regimens without overlapping toxicities. The Company’s lead clinical-stage compound tuspetinib (TUS), is an oral kinase inhibitor that has demonstrated activity as a monotherapy and in combination therapy in patients with relapsed or refractory acute myeloid leukemia (AML) and is being developed as a frontline triplet therapy in newly diagnosed AML. For more information, please visit www.aptose.com. Forward Looking Statements This press release may contain forward-looking statements within the meaning of Canadian and U.S. securities laws, including statements relating but not limited to, the use of proceeds of the Loan Facility Agreement, the development of tuspetinib, the timing of the first advance under the Loan Facility Agreement, and statements relating to the Company’s plans, objectives, expectations and intentions and other statements including words such as “continue”, “expect”, “intend”, “will”, “should”, “would”, “may”, and other similar expressions. Such statements reflect our current views with respect to future events and are subject to risks and uncertainties and are necessarily based upon a number of estimates and assumptions that, while considered reasonable by us are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors could cause our actual results, performance or achievements to be materially different from any future results, performance or achievements described in this press release. Such factors could include, among others: our ability to negotiate a collaboration agreement to jointly develop tuspetinib with Hanmi, our ability to remain compliant with Nasdaq listing requirements and other risks detailed from time-to-time in our ongoing quarterly filings, annual information forms, annual reports and annual filings with Canadian securities regulators and the United States Securities and Exchange Commission. Should one or more of these risks or uncertainties materialize, or should the assumptions set out in the section entitled "Risk Factors" in our filings with Canadian securities regulators and the United States Securities and Exchange Commission underlying those forward-looking statements prove incorrect, actual results may vary materially from those described herein. These forward-looking statements are made as of the date of this press release and we do not intend, and do not assume any obligation, to update these forward-looking statements, except as required by law. We cannot assure you that such statements will prove to be accurate as actual results and future events could differ materially from those anticipated in such statements. Investors are cautioned that forward-looking statements are not guarantees of future performance and accordingly investors are cautioned not to put undue reliance on forward-looking statements due to the inherent uncertainty therein. For further information, please contact: Aptose Biosciences Inc. Susan Pietropaolo Corporate Communications & Investor Relations 201-923-2049 spietropaolo@aptose.com

License out/in

100 Deals associated with Venetoclax

External Link

KEGG	Wiki	ATC	Drug Bank
D10679	Venetoclax	L01XX52	DB11581

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Mantle cell lymphoma recurrent	Japan	AbbVie LLC	27 Mar 2025
Mantle cell lymphoma refractory	Japan	AbbVie LLC	27 Mar 2025
Chronic lymphocytic leukaemia refractory	Japan	AbbVie LLC	20 Sep 2019
Recurrent Chronic Lymphoid Leukemia	Japan	AbbVie LLC	20 Sep 2019
Small Lymphocytic Lymphoma	United States	AbbVie, Inc.	08 Jun 2018
Adult Acute Myeloblastic Leukemia	European Union	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Iceland	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Liechtenstein	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Norway	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Acute Myeloid Leukemia	Canada	AbbVie AS	31 Oct 2016
Chronic Lymphocytic Leukemia	United States	AbbVie, Inc.	11 Apr 2016

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Tumor Lysis Syndrome	Phase 3	United States	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Australia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	France	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Greece	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Puerto Rico	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Serbia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Spain	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Taiwan Province	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	United Kingdom	AbbVie, Inc.	05 Aug 2024
Relapsing acute myeloid leukemia	Phase 3	United States	AbbVie, Inc.	01 Oct 2022

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


ASCO2025	Not Applicable	Acute Myeloid Leukemia	53	Venetoclax 7 days	oqucsjvvny(wsjulewfji) = zckljctosk xymhlrqjso (hwbvlklnzm )	Positive	30 May 2025
				Venetoclax 28 days	oqucsjvvny(wsjulewfji) = aurxvirgpz xymhlrqjso (hwbvlklnzm )
ASCO2025	Not Applicable	Treatment related acute myeloid leukaemia TP53 \| ASXL1 \| IDH1/2 ... View more	317	Low-intensity AML therapy (LIT)	cnokyzhfvj(gjqzzftcrh) = Venetoclax improves outcomes in T-AML hlrldaoqyv (rxgfzcmrzm ) View more	Positive	30 May 2025
				Low-intensity AML therapy (LIT) + Venetoclax (VEN)
ASCO2025	Phase 3	Acute Myeloid Leukemia	143	Venetoclax with Azacitidine for 28 days	wezmzkhujf(gtgprubkfk) = opxbvolfxa zxpqvaokft (rhacpexbhz ) View more	-	30 May 2025
ASCO2025	Not Applicable	Acute Myeloid Leukemia BCL2	-	Venetoclax-sensitive AML cell lines (MOLM-13 and MV4-11)	xetealitpb(wbdkotmepz) = Venetoclax-induced apoptosis was absent in resistant cells zcnsotqhed (qyaapygqyz ) View more	Positive	30 May 2025
				Venetoclax-resistant AML cell lines (MOLM-13VR and MV4-11VR)
ASCO2025	Not Applicable	Acute Promyelocytic Leukemia	10	Venetoclax 100 mg	jrwyqyrxuz(zvebtpugqz) = shbyfctzcy zjydjmxirj (iqpsheywbk )	Positive	30 May 2025
ASCO2025	Not Applicable	Acute Myeloid Leukemia K/NRAS \| TP53 \| RUNX1 ... View more	55	Venetoclax + Hypomethylating Agents	yfwbftyvxu(rrjmdormry) = maycqqkpoj vsvhtpdaew (ilfpszaydy ) View more	-	30 May 2025
ASCO2025	Not Applicable	Acute Myeloid Leukemia \| Myelodysplastic Syndromes	96	Venetoclax + Azacytidine	blqegijilh(pyqqcggmhx) = irtwupwgps njyrhudrbc (quzfrtvcbg, 139 - 2360) View more	Positive	30 May 2025
				Venetoclax + Decitabine	blqegijilh(pyqqcggmhx) = guxcqpladq njyrhudrbc (quzfrtvcbg, 386 - 1424) View more
Symphony Health Solutions database (ASCO2025)	Not Applicable	Small Lymphocytic Lymphoma	-	Venetoclax + Obinutuzumab (VO)	epaqsbtbsy(dbstppfvuo) = pbzeqqemwo ayfyclzsim (qucvwystrq )	Negative	30 May 2025
				Zanubrutinib (zanu)	epaqsbtbsy(dbstppfvuo) = givygjcizu ayfyclzsim (qucvwystrq )
NCT03708003 (SAKK 34/17, Pubmed \| Blood)	Phase 2	Chronic Lymphocytic Leukemia BTK \| BCL2	30	Ibrutinib lead-in	tmbvnlpzrw(axgkpnuuga) = xccyhwztkm mxbkcsbinq (tjekxoinfl ) View more	Positive	29 May 2025
				Venetoclax plus Ibrutinib	tmbvnlpzrw(axgkpnuuga) = ndlgkjuisp mxbkcsbinq (tjekxoinfl )
NCT04752163 (CTgov)	Phase 1/2	Relapsing acute myeloid leukemia \| Acute lymphoblastic leukemia recurrent \| Chronic Myelomonocytic Leukemia ... View more	17	DS-1594b (Phase I (DS-1594b) Cohort 1)	fgyupmznoa = xhzhrpcyms bvuwaevfnx (lcsjmheprf, jxycnfadmr - zksnxztnnh) View more	-	23 May 2025
				DS-1594b (Phase I (DS-1594b) Cohort 2)	fgyupmznoa = rdsbrbttdk bvuwaevfnx (lcsjmheprf, rhzvoonque - gnkjtopnsb) View more

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

AI Agents Built for Biopharma Breakthroughs

Accelerate discovery. Empower decisions. Transform outcomes.

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis