This phase III trial studies using risk factors in determining treatment for children with favorable tissue (histology) Wilms tumors (FHWT). Wilms Tumor is the most common type of kidney cancer in children, and FHWT is the most common subtype. Previous large clinical trials have established treatment plans that are likely to cure most children with FHWT, however some children still have their cancer come back (called relapse) and not all survive. Previous research has identified features of FHWT that are associated with higher or lower risks of relapse. The term "risk" refers to the chance of the cancer coming back after treatment. Using results of tumor histology tests, biology tests, and response to therapy may be able to improve treatment for children with FHWT.

Start Date31 Mar 2025

Sponsor / Collaborator

The Children's Oncology Group Foundation, Inc.

NCT06647953

/ Not yet recruitingPhase 3IIT

Prospective Treatment of Types I, II and III Pleuropulmonary Blastoma (PPB)

This phase III trial tests how well surgery plus chemotherapy compared to surgery alone works in treating patients with type I pleuropulmonary blastoma (PPB), and tests how well surgery plus standard chemotherapy with the addition of topotecan works compared to surgery plus standard chemotherapy alone in treating patients with type II and III PPB.
Historically, most children with type I PPB had surgery and approximately 40% of children with type I PPB received chemotherapy following their surgery, usually for 22-42 weeks. There has not been a consistent standard for which children with type I PPB receive chemotherapy after surgery. For patients whose tumor has been removed completely with surgery, observation without chemotherapy may work as well as giving chemotherapy after surgery in preventing a return of the PPB tumor.
The standard chemotherapy for patients with types II or III PPB in the United States is four cycles of IVADo (ifosfamide, vincristine, dactinomycin, and doxorubicin) followed by 8 cycles of IVA (ifosfamide, vincristine and dactinomycin). Ifosfamide is in a class of medications called alkylating agents. It works by slowing or stopping the growth of tumor cells in the body. Vincristine is in a class of medications called vinca alkaloids. It works by stopping tumor cells from growing and dividing and may kill them. Dactinomycin is a type of antibiotic that is only used in cancer chemotherapy (antineoplastic antibiotic). It works by damaging the cell's deoxyribonucleic acid (DNA) and may kill tumor cells. Doxorubicin is in a class of medications called anthracyclines. Doxorubicin damages the cell's DNA and may kill tumor cells. It also blocks a certain enzyme needed for cell division and DNA repair. Topotecan is in a class of medications called topoisomerase I inhibitors. It works by interfering with tumor cell DNA which kills them. Giving topotecan in addition to standard IVADo and IVA chemotherapy regimens may shrink the cancer as well as or better than the standard therapy or could decrease the chance the tumor spreads while causing fewer side effects.

Start Date17 Mar 2025

Sponsor / Collaborator

The Children's Oncology Group Foundation, Inc.

NCT06020755

/ RecruitingPhase 2IIT

Efficacy and Safety of Toripalimab Plus Actinomycin-D As Fist-Line Treatment in Patients with Gestational Trophoblastic Neoplasia with FIGO Score 7: a Single-Arm, Multicenter, Phase II Trial

The goal of this clinical trial is to evaluate the efficacy and safety of toripalimab plus actinomycin-D as fist-line treatment in patients with gestational trophoblastic neoplasia with FIGO score 7. The main questions it aims to answer are:
* Whether toripalimab plus actinomycin-D as fist-line treatment can achieve a high complete response rate.
* Whether an equally high cure rate can be achieved by multi-drug chemotherapy as second-line treatment in patients who have failed fist-line treatment with toripalimab plus actinomycin-D.
Participants will receive toripalimab plus actinomycin-D. Treatment will be continued until disease progression, unacceptable toxicity, or withdrawal of consent. Treatment will be completed after 4 consolidation cycles.

Start Date01 Dec 2024

Sponsor / Collaborator

Peking Union Medical College Hospital

[+7]

100 Clinical Results associated with Dactinomycin

100 Translational Medicine associated with Dactinomycin

100 Patents (Medical) associated with Dactinomycin

23,935

Literatures (Medical) associated with Dactinomycin

01 Dec 2025·Functional & Integrative Genomics

Epigenetic modification mediated by PHF20/METTL14/HOXA13 signaling axis modulates osteogenic differentiation of mesenchymal stem cells

Article

Author: Chen, Ting ; Feng, Weijia

This study investigates the mechanism of PHF20 in osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs). BMSCs from Balb/c mouse were cultured and identified through osteogenesis, adipogenesis, and flow cytometry. After osteogenic induction, the levels of OPN and OCN in BMSCs were detected by RT-qPCR. Alizarin red staining and alkaline phosphatase (ALP) staining were used to evaluate the osteogenic differentiation ability of BMSCs. PHF20, METTL14, and HOXA13 expressions were detected by RT-qPCR and Western blot. After quantitative analysis of m6A level, RNA immunoprecipitation (RIP) was performed to measure the enrichment of IGF2BP3 or m6A on HOXA13 mRNA. HOXA13 mRNA stability was assessed after actinomycin D treatment. PHF20, METT14, and HOXA13 expressions gradually increased during osteogenic differentiation of BMSCs. Suppression of PHF20 expression repressed the osteogenic differentiation of BMSCs, mainly resulted in a decrease in OPN and OCN levels, reduced mineralization, and weakened ALP activity. Mechanistically, PHF20 elevated METTL14 expression by enhancing the enrichment of H3K4me3 on its promoter, and METTL14 strengthened HOXA13 m6A methylation to maintain HOXA13 mRNA stability through IGF2BP3. In conclusion, PHF20 elevates METTL14 expression by enhancing H3K4me3 enrichment on its promoter and enhances HOXA13 mRNA stability via IGF2BP3-mediated m6A modification, thus facilitating HOXA13 expression and eventually inducing osteogenic differentiation of BMSCs.

01 Jul 2025·Annals of Hepatology

The promoting effect of the POU3F2/METTL16/PFKM cascade on glycolysis and tumorigenesis of hepatocellular carcinoma

Article

Author: Chen, Ming ; Peng, Zhong ; Wen, Wu ; Yang, Yuan ; Hu, Guangsheng

INTRODUCTION AND OBJECTIVESDeregulation of m⁶A methylation, the most prevailing RNA modification, participates in cancer pathogenesis. METTL16, an atypical methyltransferase, functions as a pro-tumorigenic factor in hepatocellular carcinoma (HCC). Here, we explored the action of METTL16 on HCC glycolysis and the associated mechanism.MATERIALS AND METHODSExpression analysis was done by quantitative PCR, immunoblotting, or immunohistochemistry. Cell sphere formation, invasiveness, apoptosis, proliferation and viability were detected by sphere formation, transwell, flow cytometry, EdU and CCK-8 assays, respectively. Xenograft studies were performed to analyze the role in vivo. Methylated RNA immunoprecipitation (MeRIP) and RIP assays were used to verify the METTL16/PFKM relationship. PFKM mRNA stability was tested by actinomycin D treatment. Chromatin immunoprecipitation (ChIP) and luciferase assays were performed to analyze the POU3F2/METTL16 relationship.RESULTSIn HCC, METTL16 expression was elevated, and increased levels of METTL16 transcript predicted poor HCC prognosis. METTL16 deficiency resulted in suppressed HCC cell growth, invasiveness and sphere formation. Moreover, METTL16 depletion diminished HCC cell glycolysis. Mechanistically, PFKM expression was positively associated with METTL16 expression. METTL16 mediated m6A methylation to stabilize PFKM mRNA via an IGF2BP3-dependent manner. Restored PFKM expression exerted a counteracting effect on METTL16 deficiency-mediated in vitro cell phenotype alterations and in vivo xenograft growth suppression. Furthermore, POU3F2 promoted the transcription of METTL16 in HCC cells.CONCLUSIONSOur findings define the crucial role of the POU3F2/METTL16/PFKM axis in HCC pathogenesis, offering the potential opportunity to combat HCC.

01 Apr 2025·International Journal of Biological Macromolecules

Comprehensive analysis of the xbp1 gene in Pacific abalone Haliotis discus hannai: Structure, expression, and role in heat stress response

Article

Author: Liu, Yue ; Huang, Dong ; Yu, Xiaojun ; Li, Xinxin ; Qin, Gaochan ; Chen, Zhichu ; Zhang, Wenbing ; Mai, Kangsen ; Pan, Mingzhu

The present study explores the x-box binding protein 1 (xbp1) gene in Haliotis discus hannai (Pacific abalone), focusing on its structure, expression, and functional role under heat stress. Southern blot revealed two copies of xbp1 in the intestine and mantle, one in the gill and muscle, and no detection in the digestive gland. mRNA expression level of xbp1 was highest in the gill, followed by the mantle, intestine, and muscle, with the digestive gland showing the lowest expression. Actinomycin D treatment demonstrated that xbp1 mRNA stability varied among tissues, with slower degradation in the gill and mantle, while rapid degradation was observed in the digestive gland. Heat stress caused a 20 bp fragment removal from xbp1 mRNA, producing spliced xbp1 (xbp1s), with a conserved inositol-requiring enzyme 1α (IRE1α) cleavage motif (5'- CAGCACCUGCUGAUCCUCUG -3'). Genome walking was used to obtain the promoter sequences of downstream genes regulated by xbp1s. Through sequence conservation analysis, the binding sites of xbp1s on these promoters were identified in Pacific abalone. Yeast one-hybrid (Y1H) assays confirmed xbp1s binding to these sites, and morpholino oligonucleotides (MO) treatment effectively suppressed xbp1s production. Western blot analysis demonstrated that heat stress induced the expression of HDEL-related proteins, while MO injection significantly reduced their expression under both basal and heat stress conditions. Immunofluorescence analysis revealed decreased endoplasmic reticulum (ER) chaperone glucose-regulated protein 78 (GRP78) levels and increased apoptosis in MO-treated abalone under heat stress, suggesting a compromised ER stress response. These findings underscore XBP1's crucial role in regulating ER stress management and apoptotic processes, providing new insights into the functional significance of xbp1 in abalone's response to thermal stress.

News (Medical) associated with Dactinomycin

28 Nov 2023

·www.prnewswire.com

Navigating the Evolving Market Dynamics of Bone Sarcoma: A Comprehensive Analysis of Osteosarcoma, Ewing Sarcoma, and Chondrosarcoma | DelveInsight

Each individual's risk of being diagnosed with primary bone sarcoma and their chances of recovery following diagnosis are influenced by a range of unique factors. In 2023, it is anticipated that 4K individuals of all ages in the United States will be diagnosed with primary bone sarcoma, including 2K males and 1.8K females. In 2020, approximately 400 cases were reported among those aged 15 to 19. LAS VEGAS, Nov. 28, 2023 /PRNewswire/ -- Bone sarcoma is a rare and aggressive form of cancer that originates in the bone tissue. It poses significant challenges during its treatment due to several factors. Firstly, its rarity often leads to delayed diagnosis, as symptoms can mimic other common conditions. Additionally, bone sarcoma typically affects children and young adults, making the emotional toll of the disease particularly challenging. Treatment often involves a combination of surgery, chemotherapy, and radiation therapy, which can be physically demanding and cause severe side effects. Moreover, because bone sarcoma tends to occur in the extremities, treatment may require complex and lengthy surgical procedures, potentially affecting mobility and quality of life. Furthermore, the risk of recurrence remains a constant concern, necessitating long-term monitoring and follow-up care. Despite these challenges, ongoing research and advancements in medical technology offer hope for improved outcomes and a better quality of life for those battling bone sarcoma. DelveInsight has recently released a series of epidemiology-based market reports focusing on benign bone sarcoma including Osteosarcoma Market Report, Ewing Sarcoma Market Report, and Chondrosarcoma Market Report. These reports include a comprehensive understanding of current treatment practices, historical and forecasted patient pool, emerging drugs, market share of individual therapies, and historical and forecasted market size from 2019 to 2032 segmented into 7MM [the United States, the EU-4 (Italy, Spain, France, and Germany), the United Kingdom, and Japan]. Additionally, the reports feature exhaustive analysis of prominent companies working with their emerging candidates in different stages of clinical development. Let's deep dive into the assessment of these bone sarcoma markets individually. Osteosarcoma Market Osteosarcoma is a rare bone tumor affecting having an annual incidence of 3.4 cases per million. It is the most prevalent form of bone cancer, primarily developed in the osteoblast cells of bones, with a predilection for long bones near the knee joint. However, it can also manifest in other locations, including the upper leg, lower leg, upper arm, and virtually any bone in the body, including those in the pelvis, shoulder, and skull. It has the potential to invade adjacent tissues, such as tendons and muscles, and can metastasize to distant organs or other bones via the bloodstream. As per DelveInsight analysts, the total incident population of osteosarcoma in the 7MM was ~2K in 2022. The estimates show the highest incident cases of osteosarcoma in the United States with ~1K cases in 2022, and it is expected to increase by 2032. Osteosarcoma is commonly treated through a combination of chemotherapy, surgery, and radiation therapy. Despite some recent developments, limited progress has been achieved since the late 1980s when chemotherapy was added to surgical treatment, leading to improved survival rates. Radiation therapy impacts both normal and cancerous cells, causing various effects. Chemotherapeutic drugs like cisplatin, doxorubicin, ifosfamide, and high-dose methotrexate with leucovorin calcium rescue (HDMTX) are widely used. Additionally, a few FDA-approved products, such as FUSILEV and KHAPZORY, are available for osteosarcoma treatment. As per DelveInsight analysis, the osteosarcoma market size is expected to increase at a significant CAGR by 2032. This growth would be fuelled by the increase in the patient pool and the expected entry of emerging therapies. Osteosarcoma Pipeline Therapies and Companies Lenvatinib: Eisai Naxitamab: Y-mAbs Therapeutics BAY80-6946: Bayer Vactosertib: MedPacto For a comprehensive view of the osteosarcoma market, check out the Osteosarcoma Market Assessment Ewing Sarcoma Market Ewing Sarcoma, a malignant tumor, typically initiates its growth within the bones, with a higher incidence among children and young adults, often manifesting during adolescence. Although it can originate in any bone, it predominantly affects the long bones, such as the thigh bone, shin bone, and upper arm bone. The pelvis bones are also frequently involved. In some cases, the tumor may originate in muscle and soft tissues. Common symptoms include bone stiffness, pain, swelling, or tenderness, along with tissue surrounding the affected bone. As per the assessment done by DelveInsight, the total incident cases of Ewing sarcoma in the 7MM comprised approximately 1.2K cases in 2022 and are projected to increase during the forecasted period. The management of Ewing sarcoma typically adopts a comprehensive approach, which may encompass surgery, chemotherapy, and radiation therapy. The National Comprehensive Cancer Network (NCCN) offers specific chemotherapy regimens for localized and metastatic Ewing sarcoma. For first-line treatment, NCCN suggests VDC/IE (vincristine, doxorubicin, and cyclophosphamide alternating with ifosfamide and etoposide), VAIA (vincristine, doxorubicin, ifosfamide, and dactinomycin), and VIDE (vincristine, ifosfamide, doxorubicin, and etoposide) for both initial presentations and as primary therapy for metastatic disease. In the second-line setting, NCCN recommends options like Cyclophosphamide and topotecan, Irinotecan + temozolomide ± Vincristine, Ifosfamide, carboplatin, etoposide, and Lurbinectedin. As per the latest Ewing Sarcoma Market Report, the total Ewing sarcoma market size in the 7MM is approximately USD 26 million in 2022 and is projected to increase during the forecast period (2023–2032). The expected introduction of upcoming therapies and the deepened integration of early patient screening, medication management in secondary care, and diverse clinical setups, ongoing research into optimal implementation approaches, and a surge in public awareness will ultimately pave the way for the advancement of efficient treatment choices. Ewing Sarcoma Pipeline Therapies and Companies SECLIDEMSTAT (SP-2577): Salarius Pharmaceuticals ZEPZELCA (LURBINECTEDIN): Jazz Pharmaceuticals and PharmaMar VERZENIO (ABEMACICLIB): Eli Lilly IBRANCE (PALBOCICLIB): Pfizer MECBOTAMAB VEDOTIN (BA3011): Bioatla IOPOFOSINE I 131 (CLR 131): Cellectar Biosciences TP-1287: Sumitomo Pharma Oncology NBRX-109: Inhibrx Explore in-depth for a comprehensive understanding of the Ewing Sarcoma Clinical Trials Chondrosarcoma Market Chondrosarcoma comprises a group of bone tumors originating from cells that overproduce cartilage. Among these tumors, conventional chondrosarcoma is the most frequent type and is generally associated with slow growth. Conversely, rarer subtypes like dedifferentiated chondrosarcoma, myxoid chondrosarcoma, clear cell chondrosarcoma, and mesenchymal chondrosarcoma tend to exhibit a more aggressive growth pattern and have the potential to spread to distant body parts. DelveInsight estimated that the total incident cases of chondrosarcoma in the 7MM comprised approximately 2K cases in 2022 and are projected to increase during the forecasted period. The management approach for chondrosarcoma is contingent upon factors like tumor type, grade, and location, with the grading system serving as the most reliable indicator of clinical prognosis. It is firmly established that surgical intervention remains the gold standard and sole effective treatment for chondrosarcoma, as alternative modalities such as radiotherapy and chemotherapy exhibit limited responsiveness and resistance. Surgical options encompass curettage, radical resection, and amputation, each necessitating comprehensive clinical judgment and contingent upon variables such as lesion size, location, and malignant characteristics. Anticipated advancements in upcoming therapies and increased integration of early patient screening and medication within secondary care and other clinical settings, along with ongoing research to determine the best implementation methods, are expected to contribute to the development of more effective treatment options. However, chondrosarcoma, being an orphan disease, presents challenges in conducting clinical trials. Limited outcome data for locally advanced or metastatic patients underscore the need for new treatment approaches. Phase I trials, due to their small number of chondrosarcoma patients at varying dose levels, make it difficult to draw definitive conclusions. Nevertheless, some Phase II trials have yielded promising results, warranting further investigation. Encouraging retrospective studies could help augment the currently limited data. Urgent efforts to boost research studies on this orphan disease are imperative. As per DelveInsight analysis, the total market size of chondrosarcoma in the 7MM is approximately USD 9 million in 2022 and is projected to increase at a massive CAGR of 24.8% due to increasing awareness of the disease and the launch of the emerging therapy. Chondrosarcoma Pipeline Therapies and Companies INBRX-109: Inhibrx To access a complete analysis of the chondrosarcoma market, visit Chondrosarcoma Market Assessment Trending Oncology Reports Non-Small Cell Lung Cancer Market Non-Small Cell Lung Cancer Market Insights, Epidemiology, and Market Forecast – 2032 report delivers an in-depth understanding of the disease, historical and forecasted epidemiology, as well as the market trends, market drivers, market barriers, and key NSCLC companies, including EMD Serono, Merck, Cellular Biomedicine Group, Inc., Celgene, CellSight Technologies, Inc., BeyondSpring Pharmaceuticals Inc., J Ints Bio, Forward Pharmaceuticals Co., Ltd., AstraZeneca, Bristol-Myers Squibb, Teligene US, Rain Oncology Inc, ReHeva Biosciences, Inc., Amgen, Novartis, RedCloud Bio, Parexel, Vitrac Therapeutics, LLC, Mythic Therapeutics, Instil Bio, Mirati Therapeutics Inc., Daiichi Sankyo, Inc., AstraZeneca, Precision Biologics, Inc, Promontory Therapeutics Inc., Palobiofarma SL, Regeneron Pharmaceuticals, Revolution Medicines, Inc., Cullinan Oncology, LLC, Iovance Biotherapeutics, Inc., Innate Pharma, among others. Non-Hodgkin Lymphoma Market Non-Hodgkin Lymphoma Market Insights, Epidemiology, and Market Forecast – 2032 report delivers an in-depth understanding of the disease, historical and forecasted epidemiology, as well as the market trends, market drivers, market barriers, and key NHL companies, including GAbbVie, Genmab, Novartis, Angiocrine Bioscience, Autolus, Zentera Therapeutics, Jiangsu Hengrui Medicine, among others. Oncolytic Virus Cancer Therapies Market Oncolytic Virus Cancer Therapies Market Insights, Epidemiology, and Market Forecast – 2032 report delivers an in-depth understanding of the disease, historical and forecasted epidemiology, as well as the market trends, market drivers, market barriers, and key oncolytic virus cancer therapies companies, including Targovax, Replimune, Genelux Corporation, Candel Therapeutics, DNAtrix, SillaJen, Treovir, Lokon Pharma AB, Istari Oncology, CG Oncology, Amgen, Daiichi Sankyo, among others. Multiple Myeloma Market Multiple Myeloma Market Insights, Epidemiology, and Market Forecast – 2032 report delivers an in-depth understanding of the disease, historical and forecasted epidemiology, as well as the market trends, market drivers, market barriers, and key multiple myeloma companies, including Johnson & Johnson (Janssen), Pfizer, AbbVie and Roche (Genentech), Regeneron Pharmaceuticals, Bristol-Myers Squibb, Celgene, Roche (Genentech), Arcellx, Novartis, Regeneron Pharmaceuticals, BeiGene, CARsgen Therapeutics, Cartesian Therapeutics, C4 Therapeutics, Heidelberg Pharma, Bristol-Myers Squibb, RAPA Therapeutics, AbbVie (TeneoOne), Takeda, among others. Oncology Conference Coverage Services DelveInsight's Oncology Conference Coverage Services deliver a comprehensive examination of conference outcomes from a range of prominent events, such as ASCO, ESMO, ASH, AACR, ASTRO, SOHO, SITC, European CAR T-cell Meeting, and IASLC 2023. This in-depth analysis equips businesses with the insights they need for effective competitive intelligence and forecasting market trends, aiding in the development of future strategies. About DelveInsight DelveInsight is a leading healthcare-focused market research and consulting firm that provides clients with high-quality market intelligence and analysis to support informed business decisions. With a team of experienced industry experts and a deep understanding of the life sciences and healthcare sectors, we offer customized research solutions and insights to clients across the globe. Get hassle-free access to all the healthcare and pharma market research reports through our subscription-based platform PharmDelve . Contact Us Shruti Thakur [email protected] +1(919)321-6187 Logo: SOURCE DelveInsight Business Research, LLP

Phase 2Clinical ResultRadiation TherapyASCO

12 Jul 2022

·www.biospace.com

Oncology Pharma Conducting Interviews and Presentations with Investors to Pursue Next Steps to Forward The Development Process of Nanoemulsion Drug Delivery System

SAN FRANCISCO, CA / ACCESSWIRE / July 12, 2022 / Oncology Pharma Inc. (OTC PINK:ONPH) - Oncology Pharma, Inc. ("The Company") is furthering progress in discussions with investors and developing the financing model towards the next step of the development process with its Nanoemulsion drug delivery system. The Company is confident that it will progress towards this next step. The early feasibility study was intended to serve as a demonstration that the development team possessed the capability of formulating research-scale nanoemulsion formulations of dactinomycin. Initial characterization of these formulations would be carried out to demonstrate that the nanoemulsion formulation possessed several desirable characteristics that made them suitable candidates for further nonclinical development. As stated the Company is confident these steps were met and looks forward to moving ahead. Essentially, all of the specific aims under the scope of this project were met. The capability to formulate nanoemulsions that incorporate the active pharmaceutical ingredient, dactinomycin, was demonstrated. Specifically, the study identified two formulations feasible for further development. The capability to be able to innovate and make progress in this early stage demonstrates the team's ability to identify developmental goals and overcome formulation challenges to produce a drug formulation with suitable characteristics for further, formal nonclinical development. These characteristics include the ability for the nanoemulsion to incorporate the majority of available drug into the lipid nanoparticles, a demonstrated release-over-time profile, and stability during storage. Additionally, test methods were established at independent contract laboratories to support basic formulation characterization and accurately detecting the drug concentration in control and test formulations in support of future nonclinical studies. ABOUT ONCOLOGY PHARMA, INC. ONCOLOGY PHARMA, INC. (OTC PINK:ONPH) (the "Company") is currently engaging in research and development of therapeutics for oncology and prides itself for having a world-class Advisory Board that keeps the Company in the forefront of developing technologies in cancer research, biotechnology, and healthcare. FORWARD-LOOKING STATEMENTS Certain of the matters discussed in this announcement contain forward-looking statements that involve material risks to and uncertainties in the Company's business that may cause actual results to differ materially from those anticipated by the statements made herein. Such risks and uncertainties include risks related to licensing arrangements and joint ventures, including the need to negotiate the definitive agreements for the relationships; possible failure to realize anticipated benefits of business relationships; and, costs of providing funding to these business relationships. Other risks and uncertainties relating to the Company include, among other things, current negative operating cash flows and a need for additional funding to finance our operating plan; the terms of any further financing, which may be highly dilutive and may include onerous terms; unexpected costs and operating deficits, and lower than expected sales and revenues; uncertain willingness and ability of customers to adopt new technologies and other factors that may affect further market acceptance; adverse economic conditions; adverse results of any legal proceedings; the volatility of our operating results and financial condition; inability to attract or retain qualified senior management personnel, including sales and marketing personnel; our ability to establish and maintain the proprietary nature of our technology through the patent process, as well as our ability to possibly license from others patents and patent applications necessary to develop products; the Company's ability to implement its long range business plan for various applications of its technology; the Company's ability to enter into agreements with any necessary marketing and/or distribution partners and with any strategic or joint venture partners; the impact of competition; the obtaining and maintenance of any necessary regulatory clearances applicable to applications of the Company's technology; management of growth; and, other risks and uncertainties. This is not a solicitation to buy or sell securities and does not purport to be an analysis of the Company's financial position. CONTACTS: For additional Information, please contact the Oncology Pharma at: One Sansome Street, Suite 3500 San Francisco, CA 94104 Phone: 415-869-1038 Fax: 415-946-8801 website: email: info@oncology-pharma.com SOURCE: Oncology Pharma Inc. View source version on accesswire.com:

08 Jun 2022

·www.biospace.com

Oncology Pharma Announces: Initial Feasibility Study of the Nanoemulsion Drug Delivery System is Complete and Results Have Met the Threshold for Moving Forward To the Next Steps of Development

SAN FRANCISCO, CA / ACCESSWIRE / June 8, 2022 / Oncology Pharma Inc. (OTC PINK:ONPH) - Oncology Pharma, Inc. ("The Company") is pleased that the initial feasibility stage is complete and results have met the threshold to move forward. The formulation under development consisted of the active pharmaceutical ingredient (dactinomycin) encapsulated in a saturated lipid and combined with various emulsifiers, surfactants, and stabilizers. The specific identity and ratios of these ingredients, along with the processing methods and processing parameters utilized, lead to formulations with very different characteristics. Various qualitative assessments (described in the previous section) were performed on the various iterations of the formulations and included: Test for drug incorporation Test for release over time The most promising formulation candidates (i.e., those which demonstrated acceptable feasibility using qualitative assessments) were forwarded to an analytical laboratory for initial characterization, which included: Test for physical properties Tests for formulation drug concentration During the feasibility stage of this project, the Company sought to acquire research and development equipment, establish an early-phase formulation laboratory, verify the capability of developing lipid nanoemulsions, and identify some promising formulations for further development. All goals were successfully accomplished. The data provided a high-level overview of the various formulations that were created and evaluated during this feasibility stage. Essentially, all of the specific aims under the scope of this project were met. The capability to formulate nanoemulsions that incorporate the active pharmaceutical ingredient, dactinomycin, was demonstrated. Specifically, the Company identified two formulations feasible for further development based on the following: The nanoparticle size was approximately 200 nm, which would improve drug delivery at the tumor site. The nanoparticles did not aggregate during storage at 40 C, which enables commercial viability. Dactinomycin incorporation in the nanoparticles was approximately 100% Drug release-over-time study showed about 50% of the drug is retained at 3 hrs. There is 1 mg dactinomycin in 4 ml of nanoemulsion, which is within the range of standard dose administration. The capability to be able to innovate and make progress in this early stage demonstrates the Company's ability to identify developmental goals and overcome formulation challenges to produce a drug formulation with suitable characteristics for further, formal nonclinical development. These characteristics include the ability for the nanoemulsion to incorporate the majority of available drug into the lipid nanoparticles, a demonstrated release-over-time profile, and stability during storage. Additionally, test methods were established at independent contract laboratories to support basic formulation characterization and accurately detecting the drug concentration in control and test formulations in support of future nonclinical studies. Oncology Pharma is committed to finding the path to further development of our licensed technologies and developing the financial model to see this through to the next phases. The Company is reviewing feasibility of some initial applications to the FDA that could enhance the development process. ABOUT ONCOLOGY PHARMA, INC. ONCOLOGY PHARMA, INC. (OTCPK:ONPH) (the "Company") is currently engaging in research and development of therapeutics for oncology and prides itself for having a world-class Advisory Board that keeps the Company in the forefront of developing technologies in cancer research, biotechnology, and healthcare. FORWARD LOOKING STATEMENTS Certain of the matters discussed in this announcement contain forward-looking statements that involve material risks to and uncertainties in the Company's business that may cause actual results to differ materially from those anticipated by the statements made herein. Such risks and uncertainties include risks related to licensing arrangements and joint ventures, including the need to negotiate the definitive agreements for the relationships; possible failure to realize anticipated benefits of business relationships; and, costs of providing funding to these business relationships. Other risks and uncertainties relating to the Company include, among other things, current negative operating cash flows and a need for additional funding to finance our operating plan; the terms of any further financing, which may be highly dilutive and may include onerous terms; unexpected costs and operating deficits, and lower than expected sales and revenues; uncertain willingness and ability of customers to adopt new technologies and other factors that may affect further market acceptance; adverse economic conditions; adverse results of any legal proceedings; the volatility of our operating results and financial condition; inability to attract or retain qualified senior management personnel, including sales and marketing personnel; our ability to establish and maintain the proprietary nature of our technology through the patent process, as well as our ability to possibly license from others patents and patent applications necessary to develop products; the Company's ability to implement its long range business plan for various applications of its technology; the Company's ability to enter into agreements with any necessary marketing and/or distribution partners and with any strategic or joint venture partners; the impact of competition; the obtaining and maintenance of any necessary regulatory clearances applicable to applications of the Company's technology; management of growth; and, other risks and uncertainties. This is not a solicitation to buy or sell securities and does not purport to be an analysis of the Company's financial position. CONTACTS: For additional Information, please contact the Oncology Pharma at: One Sansome Street, Suite 3500 San Francisco, CA 94104 Phone: 415-869-1038 Fax: 415-946-8801 website: email: info@oncology-pharma.com SOURCE: Oncology Pharma Inc. View source version on accesswire.com:

100 Deals associated with Dactinomycin

External Link

KEGG	Wiki	ATC	Drug Bank
D00214	Dactinomycin	L01DA01	DB00970

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Ewing Sarcoma	Japan	Nobelpharma Co., Ltd.	15 Sep 2005
Rhabdomyosarcoma	Japan	Nobelpharma Co., Ltd.	15 Sep 2005
Hodgkin's Lymphoma	China	Shaanxi Wuzhou Pharmaceutical Co Ltd	01 Jan 1995
Neuroblastoma	China	Shaanxi Wuzhou Pharmaceutical Co Ltd	01 Jan 1995
Testicular Neoplasms	China	Shaanxi Wuzhou Pharmaceutical Co Ltd	01 Jan 1995
Choriocarcinoma	Japan	Nobelpharma Co., Ltd.	16 Dec 1968
Wilms Tumor	Japan	Nobelpharma Co., Ltd.	16 Dec 1968

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Acute Myeloid Leukemia	Phase 2	Italy	Actavia Life Sciences, Inc.	-

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


NCT02567435 (ARST1431, CTgov)	Phase 3	Embryonal Rhabdomyosarcoma \| Alveolar Rhabdomyosarcoma	325	Questionnaire Administration+CYCLOPHOSPHAMIDE+Dactinomycin+Vincristine Sulfate+Irinotecan Hydrochloride (Regimen A (VAC/VI))	(qdzkohsohy) = xtyrflixjq pdlvllslam (maeqahgjhe, uatzcfkomz - uakbvfbsit) View more	-	01 Oct 2024
				Questionnaire Administration+CYCLOPHOSPHAMIDE+Dactinomycin+Vinorelbine+Vincristine Sulfate+Irinotecan Hydrochloride+Temsirolimus (Regimen B (VAC/VI/Temsirolimus))	(qdzkohsohy) = arsnymemzb pdlvllslam (maeqahgjhe, sbueoqrkut - wzahodyske) View more
SOHO2023	Not Applicable	-	-	Venetoclax + low-dose cytarabine + actinomycin D	mwyfhoijer(mtsrapepel) = 11% ykzjtmwrdv (pnxynskfio ) View more	-	01 Sep 2023
EPV281/#407 (IGCS2021)	Not Applicable	Gestational Trophoblastic Disease human chorionic gonadotropin (hCG)	115	Single-dose methotrexate regimen	(nknzhtjone) = uagzgsachq nxhephluts (ymnqqhmhre ) View more	Positive	01 Nov 2021
				Combination of methotrexate and actinomycin-D	(shhwlkoijx) = qofpfyeiml wdewysuqgu (jirfkmolsx )
NCT01014767 (CPT-SIOP-2009, CTgov)	Phase 3	Choroid Plexus Neoplasms \| Brain Cancer	27	Etoposide+Cyclophosphamide+Carboplatin+Vincristine (Standard Arm (1))	mdxdtoipho(hlsnktffnp) = rgheddcqxk eudhfvijlx (fxmhsrdxqe, yhjooousie - sxgbgqbxpx) View more	-	20 Aug 2019
				Etoposide+Cyclophosphamide+Carboplatin+doxorubicin+Dactinomycin+cisplatin+Vincristine (Doxorubicin/Cisplatin Arm (2))	mdxdtoipho(hlsnktffnp) = owiuojqvjt eudhfvijlx (fxmhsrdxqe, eorsurzqkd - onyyapoekx) View more
NCT01535053 (NRG/GOG 275, CTgov)	Phase 3	Hydatidiform Mole \| Choriocarcinoma	57	Dactinomycin (Regimen I (Dactinomycin))	ovfumpipab(wqwhtsupyo) = wvanfmzalg pfqvtnwrer (frkddvnmlq, xvmmktzpcs - lrghcvolhm) View more	-	13 Aug 2019
				Methotrexate (Regimen II (Methotrexate))	ovfumpipab(wqwhtsupyo) = xrfobchfqw pfqvtnwrer (frkddvnmlq, okeghpbaup - nwylubsfbr) View more
NCT00945009 (CTgov)	Phase 3	Wilms Tumor \| Beckwith-Wiedemann Syndrome	249	Therapeutic Conventional Surgery+Doxorubicin Hydrochloride+Dactinomycin+Vincristine Sulfate (Arm 1 (Bilateral Wilms Tumors))	(xjewkacnjx) = yerizgntrq dnnwfnwcon (tjexmnsbyv, urqhemonus - xzpcndzate) View more	-	05 Mar 2019
				Therapeutic Conventional Surgery+Doxorubicin Hydrochloride+Dactinomycin+Vincristine Sulfate (Arm 3 (DHPLN))	opeqflytce(cdlexpaumu) = shfdawkilr mrkdopvjzv (kidlkgyruh, arwdnsqaxj - uwsivmklxd) View more
NCT01323517 (CTgov)	Phase 2	Unresectable Melanoma	26	Ipilimumab+Melphalan+Dactinomycin	eeicygpnlu(nzqbfhwufq) = yqgmnlngyf kdxrrbrlow (jizwiqugrk, vplblicyhl - axnkiiggxd) View more	-	15 May 2018
NCT01055314 (ARST08P1, CTgov)	Phase 2	Sarcoma \| Childhood Rhabdomyosarcoma \| Alveolar Rhabdomyosarcoma	175	Laboratory Biomarker Analysis+Etoposide+cyclophosphamide+Doxorubicin Hydrochloride+Ifosfamide+Dactinomycin+Cixutumumab+Irinotecan Hydrochloride+Vincristine Sulfate Liposome (Group 1 (Chemotherapy, Radiation Therapy, Cixutumumab))	ldcisemqej(pgenmnimeo) = mfthvkqyfw hnmshrymyi (jidlbtepcv, jtusbqhabi - ryojnblrwm) View more	-	28 Jul 2017
				Laboratory Biomarker Analysis+Etoposide+cyclophosphamide+Temozolomide+Doxorubicin Hydrochloride+Ifosfamide+Dactinomycin+Irinotecan Hydrochloride+Vincristine Sulfate Liposome (Group 2 (Chemotherapy, Radiation Therapy, Temozolomide))	ldcisemqej(pgenmnimeo) = irbamvhkax hnmshrymyi (jidlbtepcv, ghwedagjgt - ewifnymiqz) View more
NCT00084838 (CTgov)	Phase 2	Central nervous system injury \| Childhood Central Nervous System Neoplasm \| Rhabdoid Tumor of the CNS	25	radiation therapy+etoposide+temozolomide+doxorubicin hydrochloride+methotrexate+cytarabine+dexrazoxane hydrochloride+Cyclophosphamide+Leucovorin Calcium+Filgrastim+Dactinomycin+Cisplatin+therapeutic hydrocortisone+vincristine sulfate	oclcutbcrz(agsvbbqmgf) = sukurusoqt xwvxoeplej (tdhatjfdqu, ltvovqvctg - zolmlsfrnf) View more	-	24 Dec 2015
NCT01323517 (ASCO2014)	Phase 2	Melanoma	18	ILI with melphalan and dactinomycin	(kveqorblyj) = wbczxfcafn llmrqlhghr (tbdefomgmh ) View more	-	20 May 2014
				Systemic ipilimumab	(rpagtlbhxu) = mkymtopkgf cvqrrxavrw (vukralfqoz, 0.2 - 38.5)

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

Chat with Hiro

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis